ID: 1184996020

View in Genome Browser
Species Human (GRCh38)
Location 22:48208179-48208201
Sequence CTCCCAAAGGCTTTACCGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184996020_1184996024 18 Left 1184996020 22:48208179-48208201 CCATTCGGTAAAGCCTTTGGGAG No data
Right 1184996024 22:48208220-48208242 TTATTTCCACACCTCGAGCCTGG No data
1184996020_1184996025 22 Left 1184996020 22:48208179-48208201 CCATTCGGTAAAGCCTTTGGGAG No data
Right 1184996025 22:48208224-48208246 TTCCACACCTCGAGCCTGGATGG No data
1184996020_1184996029 27 Left 1184996020 22:48208179-48208201 CCATTCGGTAAAGCCTTTGGGAG No data
Right 1184996029 22:48208229-48208251 CACCTCGAGCCTGGATGGGAGGG No data
1184996020_1184996028 26 Left 1184996020 22:48208179-48208201 CCATTCGGTAAAGCCTTTGGGAG No data
Right 1184996028 22:48208228-48208250 ACACCTCGAGCCTGGATGGGAGG No data
1184996020_1184996026 23 Left 1184996020 22:48208179-48208201 CCATTCGGTAAAGCCTTTGGGAG No data
Right 1184996026 22:48208225-48208247 TCCACACCTCGAGCCTGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184996020 Original CRISPR CTCCCAAAGGCTTTACCGAA TGG (reversed) Intergenic
No off target data available for this crispr