ID: 1184996022

View in Genome Browser
Species Human (GRCh38)
Location 22:48208192-48208214
Sequence TAAGTAGAAAAACCTCCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184996022_1184996026 10 Left 1184996022 22:48208192-48208214 CCTTTGGGAGGTTTTTCTACTTA No data
Right 1184996026 22:48208225-48208247 TCCACACCTCGAGCCTGGATGGG No data
1184996022_1184996029 14 Left 1184996022 22:48208192-48208214 CCTTTGGGAGGTTTTTCTACTTA No data
Right 1184996029 22:48208229-48208251 CACCTCGAGCCTGGATGGGAGGG No data
1184996022_1184996025 9 Left 1184996022 22:48208192-48208214 CCTTTGGGAGGTTTTTCTACTTA No data
Right 1184996025 22:48208224-48208246 TTCCACACCTCGAGCCTGGATGG No data
1184996022_1184996028 13 Left 1184996022 22:48208192-48208214 CCTTTGGGAGGTTTTTCTACTTA No data
Right 1184996028 22:48208228-48208250 ACACCTCGAGCCTGGATGGGAGG No data
1184996022_1184996032 26 Left 1184996022 22:48208192-48208214 CCTTTGGGAGGTTTTTCTACTTA No data
Right 1184996032 22:48208241-48208263 GGATGGGAGGGTATGCTTTCTGG No data
1184996022_1184996024 5 Left 1184996022 22:48208192-48208214 CCTTTGGGAGGTTTTTCTACTTA No data
Right 1184996024 22:48208220-48208242 TTATTTCCACACCTCGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184996022 Original CRISPR TAAGTAGAAAAACCTCCCAA AGG (reversed) Intergenic
No off target data available for this crispr