ID: 1184996024

View in Genome Browser
Species Human (GRCh38)
Location 22:48208220-48208242
Sequence TTATTTCCACACCTCGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184996022_1184996024 5 Left 1184996022 22:48208192-48208214 CCTTTGGGAGGTTTTTCTACTTA No data
Right 1184996024 22:48208220-48208242 TTATTTCCACACCTCGAGCCTGG No data
1184996020_1184996024 18 Left 1184996020 22:48208179-48208201 CCATTCGGTAAAGCCTTTGGGAG No data
Right 1184996024 22:48208220-48208242 TTATTTCCACACCTCGAGCCTGG No data
1184996017_1184996024 30 Left 1184996017 22:48208167-48208189 CCTGGATGATCTCCATTCGGTAA No data
Right 1184996024 22:48208220-48208242 TTATTTCCACACCTCGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184996024 Original CRISPR TTATTTCCACACCTCGAGCC TGG Intergenic
No off target data available for this crispr