ID: 1185000425

View in Genome Browser
Species Human (GRCh38)
Location 22:48242164-48242186
Sequence CCTGGAAAGGAGAGCCCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185000411_1185000425 9 Left 1185000411 22:48242132-48242154 CCCCACATTCTCCTCGCATTCCC No data
Right 1185000425 22:48242164-48242186 CCTGGAAAGGAGAGCCCAGATGG No data
1185000412_1185000425 8 Left 1185000412 22:48242133-48242155 CCCACATTCTCCTCGCATTCCCA No data
Right 1185000425 22:48242164-48242186 CCTGGAAAGGAGAGCCCAGATGG No data
1185000413_1185000425 7 Left 1185000413 22:48242134-48242156 CCACATTCTCCTCGCATTCCCAA No data
Right 1185000425 22:48242164-48242186 CCTGGAAAGGAGAGCCCAGATGG No data
1185000417_1185000425 -2 Left 1185000417 22:48242143-48242165 CCTCGCATTCCCAAAGGGGCCCC No data
Right 1185000425 22:48242164-48242186 CCTGGAAAGGAGAGCCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185000425 Original CRISPR CCTGGAAAGGAGAGCCCAGA TGG Intergenic
No off target data available for this crispr