ID: 1185000544

View in Genome Browser
Species Human (GRCh38)
Location 22:48242788-48242810
Sequence GAGAGTGCCCAGGGGATTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185000531_1185000544 20 Left 1185000531 22:48242745-48242767 CCTGCCTGGAGCACCCACCCTCA No data
Right 1185000544 22:48242788-48242810 GAGAGTGCCCAGGGGATTGAAGG No data
1185000532_1185000544 16 Left 1185000532 22:48242749-48242771 CCTGGAGCACCCACCCTCACCCA No data
Right 1185000544 22:48242788-48242810 GAGAGTGCCCAGGGGATTGAAGG No data
1185000538_1185000544 -3 Left 1185000538 22:48242768-48242790 CCCATGTGACCGCAGAAGAGGAG No data
Right 1185000544 22:48242788-48242810 GAGAGTGCCCAGGGGATTGAAGG No data
1185000535_1185000544 3 Left 1185000535 22:48242762-48242784 CCCTCACCCATGTGACCGCAGAA No data
Right 1185000544 22:48242788-48242810 GAGAGTGCCCAGGGGATTGAAGG No data
1185000539_1185000544 -4 Left 1185000539 22:48242769-48242791 CCATGTGACCGCAGAAGAGGAGA No data
Right 1185000544 22:48242788-48242810 GAGAGTGCCCAGGGGATTGAAGG No data
1185000536_1185000544 2 Left 1185000536 22:48242763-48242785 CCTCACCCATGTGACCGCAGAAG No data
Right 1185000544 22:48242788-48242810 GAGAGTGCCCAGGGGATTGAAGG No data
1185000534_1185000544 6 Left 1185000534 22:48242759-48242781 CCACCCTCACCCATGTGACCGCA No data
Right 1185000544 22:48242788-48242810 GAGAGTGCCCAGGGGATTGAAGG No data
1185000533_1185000544 7 Left 1185000533 22:48242758-48242780 CCCACCCTCACCCATGTGACCGC No data
Right 1185000544 22:48242788-48242810 GAGAGTGCCCAGGGGATTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185000544 Original CRISPR GAGAGTGCCCAGGGGATTGA AGG Intergenic
No off target data available for this crispr