ID: 1185004420

View in Genome Browser
Species Human (GRCh38)
Location 22:48267369-48267391
Sequence TTTCAATCGAGCATTTATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185004420_1185004427 26 Left 1185004420 22:48267369-48267391 CCAACATAAATGCTCGATTGAAA No data
Right 1185004427 22:48267418-48267440 GTGTGTCTCATCGTGCAGCACGG No data
1185004420_1185004425 4 Left 1185004420 22:48267369-48267391 CCAACATAAATGCTCGATTGAAA No data
Right 1185004425 22:48267396-48267418 TTCGGCCTTTGGTGTACAGAGGG No data
1185004420_1185004429 28 Left 1185004420 22:48267369-48267391 CCAACATAAATGCTCGATTGAAA No data
Right 1185004429 22:48267420-48267442 GTGTCTCATCGTGCAGCACGGGG No data
1185004420_1185004424 3 Left 1185004420 22:48267369-48267391 CCAACATAAATGCTCGATTGAAA No data
Right 1185004424 22:48267395-48267417 CTTCGGCCTTTGGTGTACAGAGG No data
1185004420_1185004422 -7 Left 1185004420 22:48267369-48267391 CCAACATAAATGCTCGATTGAAA No data
Right 1185004422 22:48267385-48267407 ATTGAAAGTCCTTCGGCCTTTGG No data
1185004420_1185004428 27 Left 1185004420 22:48267369-48267391 CCAACATAAATGCTCGATTGAAA No data
Right 1185004428 22:48267419-48267441 TGTGTCTCATCGTGCAGCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185004420 Original CRISPR TTTCAATCGAGCATTTATGT TGG (reversed) Intergenic
No off target data available for this crispr