ID: 1185009843

View in Genome Browser
Species Human (GRCh38)
Location 22:48306817-48306839
Sequence TCAGGGTTCCAGGGAGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185009843_1185009857 25 Left 1185009843 22:48306817-48306839 CCCAGAGCTCCCTGGAACCCTGA No data
Right 1185009857 22:48306865-48306887 CCAGATGCCCCAGAGCTCCCTGG No data
1185009843_1185009847 -7 Left 1185009843 22:48306817-48306839 CCCAGAGCTCCCTGGAACCCTGA No data
Right 1185009847 22:48306833-48306855 ACCCTGATCCCGCCACCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185009843 Original CRISPR TCAGGGTTCCAGGGAGCTCT GGG (reversed) Intergenic