ID: 1185009846

View in Genome Browser
Species Human (GRCh38)
Location 22:48306827-48306849
Sequence GGTGGCGGGATCAGGGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185009846_1185009857 15 Left 1185009846 22:48306827-48306849 CCTGGAACCCTGATCCCGCCACC No data
Right 1185009857 22:48306865-48306887 CCAGATGCCCCAGAGCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185009846 Original CRISPR GGTGGCGGGATCAGGGTTCC AGG (reversed) Intergenic