ID: 1185009847

View in Genome Browser
Species Human (GRCh38)
Location 22:48306833-48306855
Sequence ACCCTGATCCCGCCACCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185009839_1185009847 5 Left 1185009839 22:48306805-48306827 CCTTCCAGATGCCCCAGAGCTCC No data
Right 1185009847 22:48306833-48306855 ACCCTGATCCCGCCACCCTGTGG No data
1185009843_1185009847 -7 Left 1185009843 22:48306817-48306839 CCCAGAGCTCCCTGGAACCCTGA No data
Right 1185009847 22:48306833-48306855 ACCCTGATCCCGCCACCCTGTGG No data
1185009840_1185009847 1 Left 1185009840 22:48306809-48306831 CCAGATGCCCCAGAGCTCCCTGG No data
Right 1185009847 22:48306833-48306855 ACCCTGATCCCGCCACCCTGTGG No data
1185009844_1185009847 -8 Left 1185009844 22:48306818-48306840 CCAGAGCTCCCTGGAACCCTGAT No data
Right 1185009847 22:48306833-48306855 ACCCTGATCCCGCCACCCTGTGG No data
1185009842_1185009847 -6 Left 1185009842 22:48306816-48306838 CCCCAGAGCTCCCTGGAACCCTG No data
Right 1185009847 22:48306833-48306855 ACCCTGATCCCGCCACCCTGTGG No data
1185009838_1185009847 29 Left 1185009838 22:48306781-48306803 CCTGGAGCACAGAAACTGTTCTG No data
Right 1185009847 22:48306833-48306855 ACCCTGATCCCGCCACCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185009847 Original CRISPR ACCCTGATCCCGCCACCCTG TGG Intergenic