ID: 1185009849 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22:48306835-48306857 |
| Sequence | GACCACAGGGTGGCGGGATC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1185009849_1185009857 | 7 | Left | 1185009849 | 22:48306835-48306857 | CCTGATCCCGCCACCCTGTGGTC | No data | ||
| Right | 1185009857 | 22:48306865-48306887 | CCAGATGCCCCAGAGCTCCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1185009849 | Original CRISPR | GACCACAGGGTGGCGGGATC AGG (reversed) | Intergenic | ||