ID: 1185009849

View in Genome Browser
Species Human (GRCh38)
Location 22:48306835-48306857
Sequence GACCACAGGGTGGCGGGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185009849_1185009857 7 Left 1185009849 22:48306835-48306857 CCTGATCCCGCCACCCTGTGGTC No data
Right 1185009857 22:48306865-48306887 CCAGATGCCCCAGAGCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185009849 Original CRISPR GACCACAGGGTGGCGGGATC AGG (reversed) Intergenic