ID: 1185009850

View in Genome Browser
Species Human (GRCh38)
Location 22:48306841-48306863
Sequence AGGACAGACCACAGGGTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185009850_1185009857 1 Left 1185009850 22:48306841-48306863 CCCGCCACCCTGTGGTCTGTCCT No data
Right 1185009857 22:48306865-48306887 CCAGATGCCCCAGAGCTCCCTGG No data
1185009850_1185009863 25 Left 1185009850 22:48306841-48306863 CCCGCCACCCTGTGGTCTGTCCT No data
Right 1185009863 22:48306889-48306911 TCCCCGATCCCGCCACCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185009850 Original CRISPR AGGACAGACCACAGGGTGGC GGG (reversed) Intergenic