ID: 1185009852

View in Genome Browser
Species Human (GRCh38)
Location 22:48306845-48306867
Sequence TGGAAGGACAGACCACAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185009852_1185009863 21 Left 1185009852 22:48306845-48306867 CCACCCTGTGGTCTGTCCTTCCA No data
Right 1185009863 22:48306889-48306911 TCCCCGATCCCGCCACCCTGTGG No data
1185009852_1185009857 -3 Left 1185009852 22:48306845-48306867 CCACCCTGTGGTCTGTCCTTCCA No data
Right 1185009857 22:48306865-48306887 CCAGATGCCCCAGAGCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185009852 Original CRISPR TGGAAGGACAGACCACAGGG TGG (reversed) Intergenic