ID: 1185009853

View in Genome Browser
Species Human (GRCh38)
Location 22:48306848-48306870
Sequence ATCTGGAAGGACAGACCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185009853_1185009857 -6 Left 1185009853 22:48306848-48306870 CCCTGTGGTCTGTCCTTCCAGAT No data
Right 1185009857 22:48306865-48306887 CCAGATGCCCCAGAGCTCCCTGG No data
1185009853_1185009863 18 Left 1185009853 22:48306848-48306870 CCCTGTGGTCTGTCCTTCCAGAT No data
Right 1185009863 22:48306889-48306911 TCCCCGATCCCGCCACCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185009853 Original CRISPR ATCTGGAAGGACAGACCACA GGG (reversed) Intergenic