ID: 1185009857

View in Genome Browser
Species Human (GRCh38)
Location 22:48306865-48306887
Sequence CCAGATGCCCCAGAGCTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185009852_1185009857 -3 Left 1185009852 22:48306845-48306867 CCACCCTGTGGTCTGTCCTTCCA No data
Right 1185009857 22:48306865-48306887 CCAGATGCCCCAGAGCTCCCTGG No data
1185009851_1185009857 0 Left 1185009851 22:48306842-48306864 CCGCCACCCTGTGGTCTGTCCTT No data
Right 1185009857 22:48306865-48306887 CCAGATGCCCCAGAGCTCCCTGG No data
1185009854_1185009857 -7 Left 1185009854 22:48306849-48306871 CCTGTGGTCTGTCCTTCCAGATG No data
Right 1185009857 22:48306865-48306887 CCAGATGCCCCAGAGCTCCCTGG No data
1185009849_1185009857 7 Left 1185009849 22:48306835-48306857 CCTGATCCCGCCACCCTGTGGTC No data
Right 1185009857 22:48306865-48306887 CCAGATGCCCCAGAGCTCCCTGG No data
1185009848_1185009857 8 Left 1185009848 22:48306834-48306856 CCCTGATCCCGCCACCCTGTGGT No data
Right 1185009857 22:48306865-48306887 CCAGATGCCCCAGAGCTCCCTGG No data
1185009853_1185009857 -6 Left 1185009853 22:48306848-48306870 CCCTGTGGTCTGTCCTTCCAGAT No data
Right 1185009857 22:48306865-48306887 CCAGATGCCCCAGAGCTCCCTGG No data
1185009842_1185009857 26 Left 1185009842 22:48306816-48306838 CCCCAGAGCTCCCTGGAACCCTG No data
Right 1185009857 22:48306865-48306887 CCAGATGCCCCAGAGCTCCCTGG No data
1185009846_1185009857 15 Left 1185009846 22:48306827-48306849 CCTGGAACCCTGATCCCGCCACC No data
Right 1185009857 22:48306865-48306887 CCAGATGCCCCAGAGCTCCCTGG No data
1185009843_1185009857 25 Left 1185009843 22:48306817-48306839 CCCAGAGCTCCCTGGAACCCTGA No data
Right 1185009857 22:48306865-48306887 CCAGATGCCCCAGAGCTCCCTGG No data
1185009844_1185009857 24 Left 1185009844 22:48306818-48306840 CCAGAGCTCCCTGGAACCCTGAT No data
Right 1185009857 22:48306865-48306887 CCAGATGCCCCAGAGCTCCCTGG No data
1185009845_1185009857 16 Left 1185009845 22:48306826-48306848 CCCTGGAACCCTGATCCCGCCAC No data
Right 1185009857 22:48306865-48306887 CCAGATGCCCCAGAGCTCCCTGG No data
1185009850_1185009857 1 Left 1185009850 22:48306841-48306863 CCCGCCACCCTGTGGTCTGTCCT No data
Right 1185009857 22:48306865-48306887 CCAGATGCCCCAGAGCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185009857 Original CRISPR CCAGATGCCCCAGAGCTCCC TGG Intergenic