ID: 1185010307

View in Genome Browser
Species Human (GRCh38)
Location 22:48309189-48309211
Sequence AGCCCAGGAATCCACACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185010297_1185010307 22 Left 1185010297 22:48309144-48309166 CCAGAGCCTGGTCAGCCTCTGCA No data
Right 1185010307 22:48309189-48309211 AGCCCAGGAATCCACACTGAAGG No data
1185010301_1185010307 7 Left 1185010301 22:48309159-48309181 CCTCTGCAGCTGGCATGTGGAGT No data
Right 1185010307 22:48309189-48309211 AGCCCAGGAATCCACACTGAAGG No data
1185010299_1185010307 16 Left 1185010299 22:48309150-48309172 CCTGGTCAGCCTCTGCAGCTGGC No data
Right 1185010307 22:48309189-48309211 AGCCCAGGAATCCACACTGAAGG No data
1185010294_1185010307 28 Left 1185010294 22:48309138-48309160 CCCCTTCCAGAGCCTGGTCAGCC No data
Right 1185010307 22:48309189-48309211 AGCCCAGGAATCCACACTGAAGG No data
1185010295_1185010307 27 Left 1185010295 22:48309139-48309161 CCCTTCCAGAGCCTGGTCAGCCT No data
Right 1185010307 22:48309189-48309211 AGCCCAGGAATCCACACTGAAGG No data
1185010296_1185010307 26 Left 1185010296 22:48309140-48309162 CCTTCCAGAGCCTGGTCAGCCTC No data
Right 1185010307 22:48309189-48309211 AGCCCAGGAATCCACACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185010307 Original CRISPR AGCCCAGGAATCCACACTGA AGG Intergenic
No off target data available for this crispr