ID: 1185011074

View in Genome Browser
Species Human (GRCh38)
Location 22:48315019-48315041
Sequence TCATAAAATAACGTACCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185011074_1185011078 15 Left 1185011074 22:48315019-48315041 CCCTGGGGTACGTTATTTTATGA No data
Right 1185011078 22:48315057-48315079 CAGAGTCCACTAGGGACACCAGG No data
1185011074_1185011079 18 Left 1185011074 22:48315019-48315041 CCCTGGGGTACGTTATTTTATGA No data
Right 1185011079 22:48315060-48315082 AGTCCACTAGGGACACCAGGAGG No data
1185011074_1185011076 6 Left 1185011074 22:48315019-48315041 CCCTGGGGTACGTTATTTTATGA No data
Right 1185011076 22:48315048-48315070 TAAGCAAAGCAGAGTCCACTAGG No data
1185011074_1185011077 7 Left 1185011074 22:48315019-48315041 CCCTGGGGTACGTTATTTTATGA No data
Right 1185011077 22:48315049-48315071 AAGCAAAGCAGAGTCCACTAGGG No data
1185011074_1185011080 19 Left 1185011074 22:48315019-48315041 CCCTGGGGTACGTTATTTTATGA No data
Right 1185011080 22:48315061-48315083 GTCCACTAGGGACACCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185011074 Original CRISPR TCATAAAATAACGTACCCCA GGG (reversed) Intergenic