ID: 1185011075

View in Genome Browser
Species Human (GRCh38)
Location 22:48315020-48315042
Sequence GTCATAAAATAACGTACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185011075_1185011076 5 Left 1185011075 22:48315020-48315042 CCTGGGGTACGTTATTTTATGAC No data
Right 1185011076 22:48315048-48315070 TAAGCAAAGCAGAGTCCACTAGG No data
1185011075_1185011077 6 Left 1185011075 22:48315020-48315042 CCTGGGGTACGTTATTTTATGAC No data
Right 1185011077 22:48315049-48315071 AAGCAAAGCAGAGTCCACTAGGG No data
1185011075_1185011079 17 Left 1185011075 22:48315020-48315042 CCTGGGGTACGTTATTTTATGAC No data
Right 1185011079 22:48315060-48315082 AGTCCACTAGGGACACCAGGAGG No data
1185011075_1185011080 18 Left 1185011075 22:48315020-48315042 CCTGGGGTACGTTATTTTATGAC No data
Right 1185011080 22:48315061-48315083 GTCCACTAGGGACACCAGGAGGG No data
1185011075_1185011078 14 Left 1185011075 22:48315020-48315042 CCTGGGGTACGTTATTTTATGAC No data
Right 1185011078 22:48315057-48315079 CAGAGTCCACTAGGGACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185011075 Original CRISPR GTCATAAAATAACGTACCCC AGG (reversed) Intergenic