ID: 1185011079

View in Genome Browser
Species Human (GRCh38)
Location 22:48315060-48315082
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185011074_1185011079 18 Left 1185011074 22:48315019-48315041 CCCTGGGGTACGTTATTTTATGA No data
Right 1185011079 22:48315060-48315082 AGTCCACTAGGGACACCAGGAGG No data
1185011075_1185011079 17 Left 1185011075 22:48315020-48315042 CCTGGGGTACGTTATTTTATGAC No data
Right 1185011079 22:48315060-48315082 AGTCCACTAGGGACACCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185011079 Original CRISPR AGTCCACTAGGGACACCAGG AGG Intergenic
No off target data available for this crispr