ID: 1185011080 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:48315061-48315083 |
Sequence | GTCCACTAGGGACACCAGGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1185011075_1185011080 | 18 | Left | 1185011075 | 22:48315020-48315042 | CCTGGGGTACGTTATTTTATGAC | No data | ||
Right | 1185011080 | 22:48315061-48315083 | GTCCACTAGGGACACCAGGAGGG | No data | ||||
1185011074_1185011080 | 19 | Left | 1185011074 | 22:48315019-48315041 | CCCTGGGGTACGTTATTTTATGA | No data | ||
Right | 1185011080 | 22:48315061-48315083 | GTCCACTAGGGACACCAGGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1185011080 | Original CRISPR | GTCCACTAGGGACACCAGGA GGG | Intergenic | ||