ID: 1185011667

View in Genome Browser
Species Human (GRCh38)
Location 22:48317944-48317966
Sequence ACCGATACCCAGAGGGTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185011658_1185011667 12 Left 1185011658 22:48317909-48317931 CCCATGGCCCAGGGACTCAGAAC No data
Right 1185011667 22:48317944-48317966 ACCGATACCCAGAGGGTACCAGG No data
1185011659_1185011667 11 Left 1185011659 22:48317910-48317932 CCATGGCCCAGGGACTCAGAACC No data
Right 1185011667 22:48317944-48317966 ACCGATACCCAGAGGGTACCAGG No data
1185011652_1185011667 30 Left 1185011652 22:48317891-48317913 CCTGGCTGGTGCCTGTACCCCAT No data
Right 1185011667 22:48317944-48317966 ACCGATACCCAGAGGGTACCAGG No data
1185011660_1185011667 5 Left 1185011660 22:48317916-48317938 CCCAGGGACTCAGAACCTCTCTA No data
Right 1185011667 22:48317944-48317966 ACCGATACCCAGAGGGTACCAGG No data
1185011661_1185011667 4 Left 1185011661 22:48317917-48317939 CCAGGGACTCAGAACCTCTCTAG No data
Right 1185011667 22:48317944-48317966 ACCGATACCCAGAGGGTACCAGG No data
1185011657_1185011667 13 Left 1185011657 22:48317908-48317930 CCCCATGGCCCAGGGACTCAGAA No data
Right 1185011667 22:48317944-48317966 ACCGATACCCAGAGGGTACCAGG No data
1185011656_1185011667 19 Left 1185011656 22:48317902-48317924 CCTGTACCCCATGGCCCAGGGAC No data
Right 1185011667 22:48317944-48317966 ACCGATACCCAGAGGGTACCAGG No data
1185011662_1185011667 -10 Left 1185011662 22:48317931-48317953 CCTCTCTAGCCCTACCGATACCC No data
Right 1185011667 22:48317944-48317966 ACCGATACCCAGAGGGTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185011667 Original CRISPR ACCGATACCCAGAGGGTACC AGG Intergenic
No off target data available for this crispr