ID: 1185013453

View in Genome Browser
Species Human (GRCh38)
Location 22:48329794-48329816
Sequence TCAGGCTCACATGTTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185013453_1185013457 29 Left 1185013453 22:48329794-48329816 CCAGCAGCAACATGTGAGCCTGA No data
Right 1185013457 22:48329846-48329868 GATGAAACAGCAGCCACAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185013453 Original CRISPR TCAGGCTCACATGTTGCTGC TGG (reversed) Intergenic
No off target data available for this crispr