ID: 1185013655

View in Genome Browser
Species Human (GRCh38)
Location 22:48331287-48331309
Sequence CTGGGTAGGCAGGTGGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185013655_1185013665 6 Left 1185013655 22:48331287-48331309 CCTTGCCCCACCTGCCTACCCAG No data
Right 1185013665 22:48331316-48331338 GAAGCCCACCAACATATGGCTGG No data
1185013655_1185013664 2 Left 1185013655 22:48331287-48331309 CCTTGCCCCACCTGCCTACCCAG No data
Right 1185013664 22:48331312-48331334 TTCTGAAGCCCACCAACATATGG No data
1185013655_1185013666 7 Left 1185013655 22:48331287-48331309 CCTTGCCCCACCTGCCTACCCAG No data
Right 1185013666 22:48331317-48331339 AAGCCCACCAACATATGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185013655 Original CRISPR CTGGGTAGGCAGGTGGGGCA AGG (reversed) Intergenic
No off target data available for this crispr