ID: 1185013665

View in Genome Browser
Species Human (GRCh38)
Location 22:48331316-48331338
Sequence GAAGCCCACCAACATATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185013655_1185013665 6 Left 1185013655 22:48331287-48331309 CCTTGCCCCACCTGCCTACCCAG No data
Right 1185013665 22:48331316-48331338 GAAGCCCACCAACATATGGCTGG No data
1185013660_1185013665 -4 Left 1185013660 22:48331297-48331319 CCTGCCTACCCAGGCTTCTGAAG No data
Right 1185013665 22:48331316-48331338 GAAGCCCACCAACATATGGCTGG No data
1185013659_1185013665 -1 Left 1185013659 22:48331294-48331316 CCACCTGCCTACCCAGGCTTCTG No data
Right 1185013665 22:48331316-48331338 GAAGCCCACCAACATATGGCTGG No data
1185013661_1185013665 -8 Left 1185013661 22:48331301-48331323 CCTACCCAGGCTTCTGAAGCCCA No data
Right 1185013665 22:48331316-48331338 GAAGCCCACCAACATATGGCTGG No data
1185013658_1185013665 0 Left 1185013658 22:48331293-48331315 CCCACCTGCCTACCCAGGCTTCT No data
Right 1185013665 22:48331316-48331338 GAAGCCCACCAACATATGGCTGG No data
1185013657_1185013665 1 Left 1185013657 22:48331292-48331314 CCCCACCTGCCTACCCAGGCTTC No data
Right 1185013665 22:48331316-48331338 GAAGCCCACCAACATATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185013665 Original CRISPR GAAGCCCACCAACATATGGC TGG Intergenic
No off target data available for this crispr