ID: 1185014052

View in Genome Browser
Species Human (GRCh38)
Location 22:48333257-48333279
Sequence AAGGGGAAGCAGAGTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185014052_1185014068 30 Left 1185014052 22:48333257-48333279 CCAGCCTCACTCTGCTTCCCCTT No data
Right 1185014068 22:48333310-48333332 GCCACGCCCAGGCCTCCCATGGG No data
1185014052_1185014064 19 Left 1185014052 22:48333257-48333279 CCAGCCTCACTCTGCTTCCCCTT No data
Right 1185014064 22:48333299-48333321 CAGCCATCCTCGCCACGCCCAGG No data
1185014052_1185014067 29 Left 1185014052 22:48333257-48333279 CCAGCCTCACTCTGCTTCCCCTT No data
Right 1185014067 22:48333309-48333331 CGCCACGCCCAGGCCTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185014052 Original CRISPR AAGGGGAAGCAGAGTGAGGC TGG (reversed) Intergenic
No off target data available for this crispr