ID: 1185014375

View in Genome Browser
Species Human (GRCh38)
Location 22:48334606-48334628
Sequence TGCCCAGGGCTGAGCCGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185014365_1185014375 5 Left 1185014365 22:48334578-48334600 CCGGCCCTTGCCAGTCCAGCTCT No data
Right 1185014375 22:48334606-48334628 TGCCCAGGGCTGAGCCGGGCTGG No data
1185014368_1185014375 -5 Left 1185014368 22:48334588-48334610 CCAGTCCAGCTCTGAGCCTGCCC No data
Right 1185014375 22:48334606-48334628 TGCCCAGGGCTGAGCCGGGCTGG No data
1185014367_1185014375 0 Left 1185014367 22:48334583-48334605 CCTTGCCAGTCCAGCTCTGAGCC No data
Right 1185014375 22:48334606-48334628 TGCCCAGGGCTGAGCCGGGCTGG No data
1185014359_1185014375 26 Left 1185014359 22:48334557-48334579 CCCTCGCCTCCCGGGCTGGCACC No data
Right 1185014375 22:48334606-48334628 TGCCCAGGGCTGAGCCGGGCTGG No data
1185014371_1185014375 -10 Left 1185014371 22:48334593-48334615 CCAGCTCTGAGCCTGCCCAGGGC No data
Right 1185014375 22:48334606-48334628 TGCCCAGGGCTGAGCCGGGCTGG No data
1185014363_1185014375 17 Left 1185014363 22:48334566-48334588 CCCGGGCTGGCACCGGCCCTTGC No data
Right 1185014375 22:48334606-48334628 TGCCCAGGGCTGAGCCGGGCTGG No data
1185014366_1185014375 1 Left 1185014366 22:48334582-48334604 CCCTTGCCAGTCCAGCTCTGAGC No data
Right 1185014375 22:48334606-48334628 TGCCCAGGGCTGAGCCGGGCTGG No data
1185014362_1185014375 20 Left 1185014362 22:48334563-48334585 CCTCCCGGGCTGGCACCGGCCCT No data
Right 1185014375 22:48334606-48334628 TGCCCAGGGCTGAGCCGGGCTGG No data
1185014360_1185014375 25 Left 1185014360 22:48334558-48334580 CCTCGCCTCCCGGGCTGGCACCG No data
Right 1185014375 22:48334606-48334628 TGCCCAGGGCTGAGCCGGGCTGG No data
1185014364_1185014375 16 Left 1185014364 22:48334567-48334589 CCGGGCTGGCACCGGCCCTTGCC No data
Right 1185014375 22:48334606-48334628 TGCCCAGGGCTGAGCCGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185014375 Original CRISPR TGCCCAGGGCTGAGCCGGGC TGG Intergenic
No off target data available for this crispr