ID: 1185017390

View in Genome Browser
Species Human (GRCh38)
Location 22:48352719-48352741
Sequence GGGTGCCCAAAGCTGGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185017390_1185017403 14 Left 1185017390 22:48352719-48352741 CCCATCTCCAGCTTTGGGCACCC No data
Right 1185017403 22:48352756-48352778 TGCTTGTGGTTTCTTGGGGCTGG No data
1185017390_1185017400 8 Left 1185017390 22:48352719-48352741 CCCATCTCCAGCTTTGGGCACCC No data
Right 1185017400 22:48352750-48352772 GCTCGGTGCTTGTGGTTTCTTGG No data
1185017390_1185017402 10 Left 1185017390 22:48352719-48352741 CCCATCTCCAGCTTTGGGCACCC No data
Right 1185017402 22:48352752-48352774 TCGGTGCTTGTGGTTTCTTGGGG No data
1185017390_1185017404 15 Left 1185017390 22:48352719-48352741 CCCATCTCCAGCTTTGGGCACCC No data
Right 1185017404 22:48352757-48352779 GCTTGTGGTTTCTTGGGGCTGGG No data
1185017390_1185017401 9 Left 1185017390 22:48352719-48352741 CCCATCTCCAGCTTTGGGCACCC No data
Right 1185017401 22:48352751-48352773 CTCGGTGCTTGTGGTTTCTTGGG No data
1185017390_1185017405 24 Left 1185017390 22:48352719-48352741 CCCATCTCCAGCTTTGGGCACCC No data
Right 1185017405 22:48352766-48352788 TTCTTGGGGCTGGGCAGCCCTGG No data
1185017390_1185017394 -9 Left 1185017390 22:48352719-48352741 CCCATCTCCAGCTTTGGGCACCC No data
Right 1185017394 22:48352733-48352755 TGGGCACCCAACCCAAGGCTCGG No data
1185017390_1185017397 0 Left 1185017390 22:48352719-48352741 CCCATCTCCAGCTTTGGGCACCC No data
Right 1185017397 22:48352742-48352764 AACCCAAGGCTCGGTGCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185017390 Original CRISPR GGGTGCCCAAAGCTGGAGAT GGG (reversed) Intergenic
No off target data available for this crispr