ID: 1185017597

View in Genome Browser
Species Human (GRCh38)
Location 22:48353734-48353756
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185017597_1185017607 18 Left 1185017597 22:48353734-48353756 CCACTGCCTCCTGGAGCCACAGT No data
Right 1185017607 22:48353775-48353797 TCCAGACAGAAATGTGTCGCTGG No data
1185017597_1185017601 -8 Left 1185017597 22:48353734-48353756 CCACTGCCTCCTGGAGCCACAGT No data
Right 1185017601 22:48353749-48353771 GCCACAGTATCCAGACACCAGGG No data
1185017597_1185017609 19 Left 1185017597 22:48353734-48353756 CCACTGCCTCCTGGAGCCACAGT No data
Right 1185017609 22:48353776-48353798 CCAGACAGAAATGTGTCGCTGGG No data
1185017597_1185017603 -7 Left 1185017597 22:48353734-48353756 CCACTGCCTCCTGGAGCCACAGT No data
Right 1185017603 22:48353750-48353772 CCACAGTATCCAGACACCAGGGG No data
1185017597_1185017600 -9 Left 1185017597 22:48353734-48353756 CCACTGCCTCCTGGAGCCACAGT No data
Right 1185017600 22:48353748-48353770 AGCCACAGTATCCAGACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185017597 Original CRISPR ACTGTGGCTCCAGGAGGCAG TGG (reversed) Intergenic