ID: 1185017598

View in Genome Browser
Species Human (GRCh38)
Location 22:48353740-48353762
Sequence CTGGATACTGTGGCTCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185017598_1185017609 13 Left 1185017598 22:48353740-48353762 CCTCCTGGAGCCACAGTATCCAG No data
Right 1185017609 22:48353776-48353798 CCAGACAGAAATGTGTCGCTGGG No data
1185017598_1185017607 12 Left 1185017598 22:48353740-48353762 CCTCCTGGAGCCACAGTATCCAG No data
Right 1185017607 22:48353775-48353797 TCCAGACAGAAATGTGTCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185017598 Original CRISPR CTGGATACTGTGGCTCCAGG AGG (reversed) Intergenic