ID: 1185017604

View in Genome Browser
Species Human (GRCh38)
Location 22:48353759-48353781
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185017604_1185017609 -6 Left 1185017604 22:48353759-48353781 CCAGACACCAGGGGCCTCCAGAC No data
Right 1185017609 22:48353776-48353798 CCAGACAGAAATGTGTCGCTGGG No data
1185017604_1185017607 -7 Left 1185017604 22:48353759-48353781 CCAGACACCAGGGGCCTCCAGAC No data
Right 1185017607 22:48353775-48353797 TCCAGACAGAAATGTGTCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185017604 Original CRISPR GTCTGGAGGCCCCTGGTGTC TGG (reversed) Intergenic
No off target data available for this crispr