ID: 1185017607

View in Genome Browser
Species Human (GRCh38)
Location 22:48353775-48353797
Sequence TCCAGACAGAAATGTGTCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185017595_1185017607 20 Left 1185017595 22:48353732-48353754 CCCCACTGCCTCCTGGAGCCACA No data
Right 1185017607 22:48353775-48353797 TCCAGACAGAAATGTGTCGCTGG No data
1185017602_1185017607 2 Left 1185017602 22:48353750-48353772 CCACAGTATCCAGACACCAGGGG No data
Right 1185017607 22:48353775-48353797 TCCAGACAGAAATGTGTCGCTGG No data
1185017598_1185017607 12 Left 1185017598 22:48353740-48353762 CCTCCTGGAGCCACAGTATCCAG No data
Right 1185017607 22:48353775-48353797 TCCAGACAGAAATGTGTCGCTGG No data
1185017596_1185017607 19 Left 1185017596 22:48353733-48353755 CCCACTGCCTCCTGGAGCCACAG No data
Right 1185017607 22:48353775-48353797 TCCAGACAGAAATGTGTCGCTGG No data
1185017597_1185017607 18 Left 1185017597 22:48353734-48353756 CCACTGCCTCCTGGAGCCACAGT No data
Right 1185017607 22:48353775-48353797 TCCAGACAGAAATGTGTCGCTGG No data
1185017594_1185017607 24 Left 1185017594 22:48353728-48353750 CCATCCCCACTGCCTCCTGGAGC No data
Right 1185017607 22:48353775-48353797 TCCAGACAGAAATGTGTCGCTGG No data
1185017604_1185017607 -7 Left 1185017604 22:48353759-48353781 CCAGACACCAGGGGCCTCCAGAC No data
Right 1185017607 22:48353775-48353797 TCCAGACAGAAATGTGTCGCTGG No data
1185017599_1185017607 9 Left 1185017599 22:48353743-48353765 CCTGGAGCCACAGTATCCAGACA No data
Right 1185017607 22:48353775-48353797 TCCAGACAGAAATGTGTCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185017607 Original CRISPR TCCAGACAGAAATGTGTCGC TGG Intergenic