ID: 1185020575

View in Genome Browser
Species Human (GRCh38)
Location 22:48372392-48372414
Sequence GAGGCTGATCCCGCTGTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185020575_1185020583 5 Left 1185020575 22:48372392-48372414 CCCAGAACAGCGGGATCAGCCTC No data
Right 1185020583 22:48372420-48372442 TCCCAGAAGCCAAGTGGTGTTGG No data
1185020575_1185020581 -1 Left 1185020575 22:48372392-48372414 CCCAGAACAGCGGGATCAGCCTC No data
Right 1185020581 22:48372414-48372436 CCCGGGTCCCAGAAGCCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185020575 Original CRISPR GAGGCTGATCCCGCTGTTCT GGG (reversed) Intergenic
No off target data available for this crispr