ID: 1185021717

View in Genome Browser
Species Human (GRCh38)
Location 22:48380373-48380395
Sequence CAGGCCAGACCCAGAGCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185021717_1185021730 30 Left 1185021717 22:48380373-48380395 CCCCCGGCTCTGGGTCTGGCCTG No data
Right 1185021730 22:48380426-48380448 AGCCTCTGCTCTGCAGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185021717 Original CRISPR CAGGCCAGACCCAGAGCCGG GGG (reversed) Intergenic
No off target data available for this crispr