ID: 1185026350

View in Genome Browser
Species Human (GRCh38)
Location 22:48415699-48415721
Sequence CAGCCTTCATGCCATCCCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185026344_1185026350 14 Left 1185026344 22:48415662-48415684 CCAGCCGGTTCTCCAGCAGTCAG No data
Right 1185026350 22:48415699-48415721 CAGCCTTCATGCCATCCCCTCGG No data
1185026348_1185026350 2 Left 1185026348 22:48415674-48415696 CCAGCAGTCAGGTCTGACAGGCT No data
Right 1185026350 22:48415699-48415721 CAGCCTTCATGCCATCCCCTCGG No data
1185026346_1185026350 10 Left 1185026346 22:48415666-48415688 CCGGTTCTCCAGCAGTCAGGTCT No data
Right 1185026350 22:48415699-48415721 CAGCCTTCATGCCATCCCCTCGG No data
1185026343_1185026350 27 Left 1185026343 22:48415649-48415671 CCTGAGGAGGGCACCAGCCGGTT No data
Right 1185026350 22:48415699-48415721 CAGCCTTCATGCCATCCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185026350 Original CRISPR CAGCCTTCATGCCATCCCCT CGG Intergenic
No off target data available for this crispr