ID: 1185029209

View in Genome Browser
Species Human (GRCh38)
Location 22:48432766-48432788
Sequence AAGGGCCTGGTGAGGGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185029209_1185029216 0 Left 1185029209 22:48432766-48432788 CCTCCAGCCCTCACCAGGCCCTT No data
Right 1185029216 22:48432789-48432811 TTCCTCCCTCTCTGCCACTGAGG No data
1185029209_1185029217 1 Left 1185029209 22:48432766-48432788 CCTCCAGCCCTCACCAGGCCCTT No data
Right 1185029217 22:48432790-48432812 TCCTCCCTCTCTGCCACTGAGGG No data
1185029209_1185029219 2 Left 1185029209 22:48432766-48432788 CCTCCAGCCCTCACCAGGCCCTT No data
Right 1185029219 22:48432791-48432813 CCTCCCTCTCTGCCACTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185029209 Original CRISPR AAGGGCCTGGTGAGGGCTGG AGG (reversed) Intergenic
No off target data available for this crispr