ID: 1185029216

View in Genome Browser
Species Human (GRCh38)
Location 22:48432789-48432811
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185029210_1185029216 -3 Left 1185029210 22:48432769-48432791 CCAGCCCTCACCAGGCCCTTTTC No data
Right 1185029216 22:48432789-48432811 TTCCTCCCTCTCTGCCACTGAGG No data
1185029204_1185029216 12 Left 1185029204 22:48432754-48432776 CCTTCTGCCCACCCTCCAGCCCT No data
Right 1185029216 22:48432789-48432811 TTCCTCCCTCTCTGCCACTGAGG No data
1185029205_1185029216 5 Left 1185029205 22:48432761-48432783 CCCACCCTCCAGCCCTCACCAGG No data
Right 1185029216 22:48432789-48432811 TTCCTCCCTCTCTGCCACTGAGG No data
1185029201_1185029216 18 Left 1185029201 22:48432748-48432770 CCCCAGCCTTCTGCCCACCCTCC No data
Right 1185029216 22:48432789-48432811 TTCCTCCCTCTCTGCCACTGAGG No data
1185029209_1185029216 0 Left 1185029209 22:48432766-48432788 CCTCCAGCCCTCACCAGGCCCTT No data
Right 1185029216 22:48432789-48432811 TTCCTCCCTCTCTGCCACTGAGG No data
1185029207_1185029216 4 Left 1185029207 22:48432762-48432784 CCACCCTCCAGCCCTCACCAGGC No data
Right 1185029216 22:48432789-48432811 TTCCTCCCTCTCTGCCACTGAGG No data
1185029203_1185029216 16 Left 1185029203 22:48432750-48432772 CCAGCCTTCTGCCCACCCTCCAG No data
Right 1185029216 22:48432789-48432811 TTCCTCCCTCTCTGCCACTGAGG No data
1185029212_1185029216 -8 Left 1185029212 22:48432774-48432796 CCTCACCAGGCCCTTTTCCTCCC No data
Right 1185029216 22:48432789-48432811 TTCCTCCCTCTCTGCCACTGAGG No data
1185029208_1185029216 1 Left 1185029208 22:48432765-48432787 CCCTCCAGCCCTCACCAGGCCCT No data
Right 1185029216 22:48432789-48432811 TTCCTCCCTCTCTGCCACTGAGG No data
1185029211_1185029216 -7 Left 1185029211 22:48432773-48432795 CCCTCACCAGGCCCTTTTCCTCC No data
Right 1185029216 22:48432789-48432811 TTCCTCCCTCTCTGCCACTGAGG No data
1185029202_1185029216 17 Left 1185029202 22:48432749-48432771 CCCAGCCTTCTGCCCACCCTCCA No data
Right 1185029216 22:48432789-48432811 TTCCTCCCTCTCTGCCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185029216 Original CRISPR TTCCTCCCTCTCTGCCACTG AGG Intergenic
No off target data available for this crispr