ID: 1185033874

View in Genome Browser
Species Human (GRCh38)
Location 22:48460736-48460758
Sequence GGTCGCCTTTCCCAAGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185033868_1185033874 -6 Left 1185033868 22:48460719-48460741 CCACCACCTGCGGGCCAGGTCGC No data
Right 1185033874 22:48460736-48460758 GGTCGCCTTTCCCAAGGGCCAGG No data
1185033862_1185033874 17 Left 1185033862 22:48460696-48460718 CCTGCGGAGCTGGCAGAGTGTCC No data
Right 1185033874 22:48460736-48460758 GGTCGCCTTTCCCAAGGGCCAGG No data
1185033869_1185033874 -9 Left 1185033869 22:48460722-48460744 CCACCTGCGGGCCAGGTCGCCTT No data
Right 1185033874 22:48460736-48460758 GGTCGCCTTTCCCAAGGGCCAGG No data
1185033861_1185033874 18 Left 1185033861 22:48460695-48460717 CCCTGCGGAGCTGGCAGAGTGTC No data
Right 1185033874 22:48460736-48460758 GGTCGCCTTTCCCAAGGGCCAGG No data
1185033867_1185033874 -5 Left 1185033867 22:48460718-48460740 CCCACCACCTGCGGGCCAGGTCG No data
Right 1185033874 22:48460736-48460758 GGTCGCCTTTCCCAAGGGCCAGG No data
1185033866_1185033874 -4 Left 1185033866 22:48460717-48460739 CCCCACCACCTGCGGGCCAGGTC No data
Right 1185033874 22:48460736-48460758 GGTCGCCTTTCCCAAGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185033874 Original CRISPR GGTCGCCTTTCCCAAGGGCC AGG Intergenic