ID: 1185035579

View in Genome Browser
Species Human (GRCh38)
Location 22:48475045-48475067
Sequence CCGGCCTGTGGGAGGCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185035579_1185035601 18 Left 1185035579 22:48475045-48475067 CCCCTCTGCCTCCCACAGGCCGG No data
Right 1185035601 22:48475086-48475108 CTCTGCCTCCCGCAGGCTGGGGG No data
1185035579_1185035604 26 Left 1185035579 22:48475045-48475067 CCCCTCTGCCTCCCACAGGCCGG No data
Right 1185035604 22:48475094-48475116 CCCGCAGGCTGGGGGACCCCAGG No data
1185035579_1185035598 16 Left 1185035579 22:48475045-48475067 CCCCTCTGCCTCCCACAGGCCGG No data
Right 1185035598 22:48475084-48475106 CCCTCTGCCTCCCGCAGGCTGGG No data
1185035579_1185035600 17 Left 1185035579 22:48475045-48475067 CCCCTCTGCCTCCCACAGGCCGG No data
Right 1185035600 22:48475085-48475107 CCTCTGCCTCCCGCAGGCTGGGG No data
1185035579_1185035593 11 Left 1185035579 22:48475045-48475067 CCCCTCTGCCTCCCACAGGCCGG No data
Right 1185035593 22:48475079-48475101 TCGCCCCCTCTGCCTCCCGCAGG No data
1185035579_1185035596 15 Left 1185035579 22:48475045-48475067 CCCCTCTGCCTCCCACAGGCCGG No data
Right 1185035596 22:48475083-48475105 CCCCTCTGCCTCCCGCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185035579 Original CRISPR CCGGCCTGTGGGAGGCAGAG GGG (reversed) Intergenic
No off target data available for this crispr