ID: 1185035896

View in Genome Browser
Species Human (GRCh38)
Location 22:48476736-48476758
Sequence GCAGGATGGAGAAGGACCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185035880_1185035896 11 Left 1185035880 22:48476702-48476724 CCAGGCAGCCATGAGCGCCTGAC No data
Right 1185035896 22:48476736-48476758 GCAGGATGGAGAAGGACCTGGGG No data
1185035881_1185035896 3 Left 1185035881 22:48476710-48476732 CCATGAGCGCCTGACCCCTCCCC No data
Right 1185035896 22:48476736-48476758 GCAGGATGGAGAAGGACCTGGGG No data
1185035878_1185035896 13 Left 1185035878 22:48476700-48476722 CCCCAGGCAGCCATGAGCGCCTG No data
Right 1185035896 22:48476736-48476758 GCAGGATGGAGAAGGACCTGGGG No data
1185035877_1185035896 20 Left 1185035877 22:48476693-48476715 CCACAGGCCCCAGGCAGCCATGA No data
Right 1185035896 22:48476736-48476758 GCAGGATGGAGAAGGACCTGGGG No data
1185035879_1185035896 12 Left 1185035879 22:48476701-48476723 CCCAGGCAGCCATGAGCGCCTGA No data
Right 1185035896 22:48476736-48476758 GCAGGATGGAGAAGGACCTGGGG No data
1185035884_1185035896 -6 Left 1185035884 22:48476719-48476741 CCTGACCCCTCCCCCAGGCAGGA No data
Right 1185035896 22:48476736-48476758 GCAGGATGGAGAAGGACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185035896 Original CRISPR GCAGGATGGAGAAGGACCTG GGG Intergenic
No off target data available for this crispr