ID: 1185038178

View in Genome Browser
Species Human (GRCh38)
Location 22:48490276-48490298
Sequence GGCCGCGGCGAGCCCCCTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 204}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185038178_1185038191 26 Left 1185038178 22:48490276-48490298 CCCGGAGGGGGCTCGCCGCGGCC 0: 1
1: 0
2: 0
3: 18
4: 204
Right 1185038191 22:48490325-48490347 GGCCCGAGCTGGTGACCGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 162
1185038178_1185038190 25 Left 1185038178 22:48490276-48490298 CCCGGAGGGGGCTCGCCGCGGCC 0: 1
1: 0
2: 0
3: 18
4: 204
Right 1185038190 22:48490324-48490346 GGGCCCGAGCTGGTGACCGGCGG 0: 1
1: 0
2: 0
3: 16
4: 124
1185038178_1185038183 -7 Left 1185038178 22:48490276-48490298 CCCGGAGGGGGCTCGCCGCGGCC 0: 1
1: 0
2: 0
3: 18
4: 204
Right 1185038183 22:48490292-48490314 CGCGGCCGCGGACGTTTCTCGGG 0: 1
1: 0
2: 0
3: 1
4: 31
1185038178_1185038189 22 Left 1185038178 22:48490276-48490298 CCCGGAGGGGGCTCGCCGCGGCC 0: 1
1: 0
2: 0
3: 18
4: 204
Right 1185038189 22:48490321-48490343 CTGGGGCCCGAGCTGGTGACCGG 0: 1
1: 0
2: 4
3: 23
4: 291
1185038178_1185038186 4 Left 1185038178 22:48490276-48490298 CCCGGAGGGGGCTCGCCGCGGCC 0: 1
1: 0
2: 0
3: 18
4: 204
Right 1185038186 22:48490303-48490325 ACGTTTCTCGGGTCGTGTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 23
1185038178_1185038187 5 Left 1185038178 22:48490276-48490298 CCCGGAGGGGGCTCGCCGCGGCC 0: 1
1: 0
2: 0
3: 18
4: 204
Right 1185038187 22:48490304-48490326 CGTTTCTCGGGTCGTGTCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 36
1185038178_1185038182 -8 Left 1185038178 22:48490276-48490298 CCCGGAGGGGGCTCGCCGCGGCC 0: 1
1: 0
2: 0
3: 18
4: 204
Right 1185038182 22:48490291-48490313 CCGCGGCCGCGGACGTTTCTCGG No data
1185038178_1185038185 3 Left 1185038178 22:48490276-48490298 CCCGGAGGGGGCTCGCCGCGGCC 0: 1
1: 0
2: 0
3: 18
4: 204
Right 1185038185 22:48490302-48490324 GACGTTTCTCGGGTCGTGTCTGG 0: 1
1: 0
2: 0
3: 0
4: 20
1185038178_1185038188 15 Left 1185038178 22:48490276-48490298 CCCGGAGGGGGCTCGCCGCGGCC 0: 1
1: 0
2: 0
3: 18
4: 204
Right 1185038188 22:48490314-48490336 GTCGTGTCTGGGGCCCGAGCTGG 0: 1
1: 0
2: 1
3: 13
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185038178 Original CRISPR GGCCGCGGCGAGCCCCCTCC GGG (reversed) Intronic
900302557 1:1985468-1985490 GGCCGCTGTGGGCCGCCTCCAGG - Exonic
901226029 1:7613511-7613533 GGCAGCAACCAGCCCCCTCCAGG + Intronic
902301365 1:15504987-15505009 GGCCGCAGCCAGCACTCTCCAGG - Intronic
904563458 1:31413566-31413588 GCCCTCGGCGGGCGCCCTCCTGG + Intronic
904619028 1:31764380-31764402 GCCCGGCGCGCGCCCCCTCCCGG - Intronic
904773287 1:32893023-32893045 GCCCGCGCCGCGCCCCCTGCCGG + Intronic
905685004 1:39901717-39901739 GGGCACGGCGCGCCCCCGCCCGG - Intronic
906532825 1:46533221-46533243 GGCCGCGGCGGGCCCGGGCCAGG - Intergenic
909021315 1:70434371-70434393 GGCCCCTGAGAGCCTCCTCCTGG - Intronic
909078477 1:71081290-71081312 AGCCTCGGAGAGCCCCCTACAGG + Exonic
912576360 1:110675313-110675335 GGCCGCGGCGGGAGCTCTCCCGG - Intergenic
913969709 1:143405452-143405474 GGCAGCTGCGAGCCTCCTCATGG + Intergenic
914064082 1:144231045-144231067 GGCAGCTGCGAGCCTCCTCATGG + Intergenic
914115068 1:144735309-144735331 GGCAGCTGCGAGCCTCCTCATGG - Intergenic
914788019 1:150851193-150851215 GGCGGGGGCCAGCCCCCGCCCGG + Intronic
915599486 1:156913487-156913509 CACCGCCGGGAGCCCCCTCCAGG + Exonic
918015939 1:180632416-180632438 CGCCGCGGCCGGCCGCCTCCCGG + Intronic
919781750 1:201225754-201225776 GGCTGCTACCAGCCCCCTCCAGG - Intronic
921039611 1:211416915-211416937 GGTCGCGGCCAGCCGGCTCCAGG - Intergenic
921384070 1:214551807-214551829 GCCCCCGGCGCGCGCCCTCCCGG - Intronic
921670492 1:217918940-217918962 GGCTCCAGCGAGCCCTCTCCAGG - Intergenic
1067769897 10:49115538-49115560 GGCCGCCGCCAGCCCGCCCCGGG + Intergenic
1067852426 10:49762211-49762233 CGCGGCGGCCCGCCCCCTCCCGG - Intronic
1067937173 10:50622989-50623011 GGCTGCGCCGATTCCCCTCCAGG + Intronic
1070314241 10:75295242-75295264 GGCAGGGGCGCGCCCCCTCATGG + Intergenic
1071573813 10:86711754-86711776 CGCCGCCGCCCGCCCCCTCCCGG - Intronic
1071997454 10:91162640-91162662 CGCCGCGGCTCGTCCCCTCCAGG + Intergenic
1073099590 10:100999762-100999784 GGCCCTGGCCAGCCCCCGCCCGG - Exonic
1076676319 10:132149462-132149484 GGACGGGAAGAGCCCCCTCCAGG + Exonic
1076691266 10:132224875-132224897 GGCCACGGCGAGGCCAGTCCTGG - Intronic
1077024524 11:433324-433346 GGCCGCGCCGACCACCATCCCGG - Exonic
1077090626 11:776886-776908 GGCCGCGGGGCGCCTTCTCCAGG + Intronic
1077333043 11:1991704-1991726 GGCCGAGGAGGGCCCCCGCCCGG + Intergenic
1077674535 11:4184602-4184624 GGCAGCTGCGTGGCCCCTCCTGG + Intergenic
1077962407 11:7089470-7089492 GCCCGCGGCGTTCCCCATCCCGG + Exonic
1079106771 11:17576989-17577011 GGCTGTGGCAAGCCCACTCCAGG + Intronic
1081699837 11:45146205-45146227 CTCCGCGGCTGGCCCCCTCCCGG - Intronic
1082763133 11:57145698-57145720 GGCAGCGGCGGGCCCCATCCTGG + Intergenic
1082787276 11:57324139-57324161 GCCTGCGCCGAGTCCCCTCCGGG - Intronic
1082795734 11:57376639-57376661 CGCCGCCGCCAGCCCCCACCGGG + Intergenic
1083419889 11:62546728-62546750 GGCGGCGACGAGCCCCGTTCCGG + Exonic
1083560626 11:63670918-63670940 GGCCCCGCCGAGCCCCGCCCTGG - Intronic
1084979460 11:72821623-72821645 GGCGGCGCTGAGGCCCCTCCAGG - Intronic
1089243131 11:117098440-117098462 GGCCGCGGGGAGCCGGCTCGGGG + Intergenic
1089453317 11:118611168-118611190 GGCCGCGGCGATCGCCCTTTGGG + Intronic
1090773688 11:129944902-129944924 GGCCAGGGCGAGCCTCCCCCTGG - Exonic
1202816026 11_KI270721v1_random:46882-46904 GGCCGAGGAGGGCCCCCGCCCGG + Intergenic
1094564890 12:31590667-31590689 GGCGGCGCTGAGCCCCCTCAGGG - Intronic
1096178388 12:49538056-49538078 GGCTGCAGGGAGCCCCTTCCCGG - Intergenic
1096493021 12:52023337-52023359 TGCAGAGGCGAGCTCCCTCCTGG + Intronic
1096668156 12:53180785-53180807 GGCCGCGCGGCGCCTCCTCCAGG - Exonic
1097281022 12:57845728-57845750 GGCGGCGTCGGGCTCCCTCCCGG - Intronic
1101381220 12:104215733-104215755 GGAGGCCGCGAGCCCCCTGCCGG - Intergenic
1101813675 12:108129488-108129510 AGCCGCGGCGAGGCCCCGCGCGG - Intronic
1102258159 12:111428171-111428193 GGCGCTGGCCAGCCCCCTCCAGG - Intronic
1102911525 12:116717993-116718015 GGACTCGGCCAGCCCCCTGCAGG - Intronic
1103500079 12:121394777-121394799 GGGCTCGGCGAACCCCCTACTGG + Intronic
1104623756 12:130337443-130337465 GGCCCCGGCCAGCCCCACCCAGG - Intergenic
1104785467 12:131445416-131445438 TGCCAGGGCGAGCCCCCTCCAGG - Intergenic
1108313888 13:49220106-49220128 GGCCGCGGCCCGCCCCGGCCCGG - Intergenic
1110860569 13:80341226-80341248 GCCAACGGCGAGCCCCCCCCGGG - Intergenic
1113378031 13:109782615-109782637 GGCGGCGGCGGCCCCCCTGCGGG + Exonic
1113493620 13:110712399-110712421 GGCCGCCGCGGGTCCCCTCCGGG - Intronic
1118366772 14:65102760-65102782 AGCCGCGGCGCGGCGCCTCCTGG + Intergenic
1120765292 14:88323008-88323030 GGCCGCGGCCGGCCACCCCCTGG - Exonic
1121096251 14:91219953-91219975 GGCCTCGGGAAGCCCCCTCATGG + Intronic
1122847026 14:104505793-104505815 GGCTGCCGAGAGCCCCCGCCTGG + Intronic
1124966625 15:34437104-34437126 CGCCGCGGTGAGCCCCTCCCGGG + Intronic
1125598216 15:40900873-40900895 GGCTGGGGCCAGCCCCCACCGGG + Exonic
1125834338 15:42736741-42736763 GGCCGCGCTGAGCTCACTCCGGG - Exonic
1126738026 15:51751506-51751528 GGCCGCGGCGAGGCTCAGCCGGG + Intronic
1126850594 15:52794751-52794773 GGCCGCTGCCAGCCCACTTCCGG + Intergenic
1127982775 15:64046540-64046562 GGGCGCCCCGAGCCCCGTCCCGG - Intronic
1128149744 15:65355522-65355544 GGACGCGGCGGGCCCCTTCCCGG + Intronic
1129540416 15:76343139-76343161 GGCCGCAACGAGCCCCCGCTAGG + Intergenic
1130015180 15:80180659-80180681 GGGCTCGGCCAGCCCCCTGCAGG - Intronic
1132464734 16:72341-72363 GGTCGCGGCGAGGCCCCCCCGGG - Intronic
1132915393 16:2341005-2341027 CGCCGCTGCGCGCCCCCTGCTGG - Intergenic
1132978195 16:2720950-2720972 GGCCGCAGCGACCCTCCTCCCGG + Intergenic
1133024099 16:2980247-2980269 GGCCACGCCGAGGCCCCTCACGG + Intronic
1133121565 16:3611709-3611731 GGCCGCCGCGGGCCCGCGCCCGG - Intronic
1133171012 16:3982506-3982528 AGCCGCTGCGAGCCCCCTCAGGG + Intronic
1133311191 16:4847728-4847750 GGCCGCGCCGAGCTCCGTCAGGG - Intronic
1133371588 16:5249347-5249369 AGCCCCGGCCAGGCCCCTCCAGG - Intergenic
1136268929 16:29137134-29137156 GGCCCCGGGGAGGCCCCTTCCGG - Intergenic
1136540166 16:30924225-30924247 GGCTGCGGCGCGGCCCTTCCAGG - Intronic
1139471476 16:67180267-67180289 GGCCGCAGGGTGCCCCCACCTGG + Exonic
1140034436 16:71361559-71361581 GGCTCCAGCGAGCCCACTCCAGG - Intronic
1141462701 16:84187111-84187133 GGTCCTGGCGCGCCCCCTCCCGG + Intergenic
1141608810 16:85170094-85170116 GGACGCCGCCAGCCCCCACCAGG + Intergenic
1141880724 16:86857158-86857180 GGCCGCAGGGTGTCCCCTCCTGG - Intergenic
1142232954 16:88908382-88908404 GGCCCCGGGGAGCGGCCTCCAGG - Intronic
1144519492 17:15944740-15944762 GGGCGGGGCGAGCTCACTCCAGG - Intergenic
1144559767 17:16312122-16312144 GGCTGCGGGCAGCCCCCGCCCGG - Intronic
1144971264 17:19111197-19111219 GCCTCCGGCGCGCCCCCTCCCGG + Intergenic
1146122948 17:30211004-30211026 GGCCGGGGCGAGGTCTCTCCTGG - Intronic
1146283235 17:31558854-31558876 CGGCGCGGGGAGCCCCCTGCCGG - Intergenic
1147315395 17:39617899-39617921 GGCCGCGGGGAGGCCGCCCCGGG - Intergenic
1147879821 17:43646292-43646314 GCCAGCGCCGCGCCCCCTCCTGG + Intronic
1147945292 17:44077265-44077287 GACAGCGCCCAGCCCCCTCCTGG + Exonic
1147962538 17:44176960-44176982 GGCTGCGGCGCGCCGGCTCCTGG + Exonic
1147965844 17:44193829-44193851 GGCCGAGGCAGGCCCCCTCCAGG + Exonic
1148685055 17:49496348-49496370 CGCCGGGGCGAACCCGCTCCCGG + Intronic
1149598022 17:57875436-57875458 GGCCAGGCCCAGCCCCCTCCCGG + Intronic
1150634738 17:66905021-66905043 GCCCGGGGCCTGCCCCCTCCTGG - Intergenic
1151246182 17:72796646-72796668 GGGCACAGCGTGCCCCCTCCAGG - Intronic
1151854458 17:76710981-76711003 GGGCGCGGCGGGCTCCCTCGGGG - Intronic
1152081006 17:78187162-78187184 GGCCGCAGCCCGCCCCCTCGTGG + Exonic
1152162586 17:78678087-78678109 GGCTGAGGCCAGCCCGCTCCGGG + Intronic
1152613972 17:81329550-81329572 GGCCTGGGCCAGCCCCTTCCTGG - Intronic
1156498813 18:37543953-37543975 GACCGCACCGAGCCTCCTCCAGG - Intronic
1160349741 18:78166661-78166683 GGCCGTGGAGAGCACCATCCAGG + Intergenic
1160853621 19:1206249-1206271 GGCCGCGGCGGGAGGCCTCCCGG + Intronic
1160856558 19:1220525-1220547 GGCCCTGGGGCGCCCCCTCCCGG + Intronic
1160889719 19:1370841-1370863 GGGCGCGGAGAGCCACCTGCGGG + Exonic
1161386763 19:3998781-3998803 GGCCGGGGGCAGCCCCCGCCCGG + Intergenic
1161994605 19:7704534-7704556 GGCCCAGCCCAGCCCCCTCCTGG + Intergenic
1162312379 19:9914655-9914677 GGCCCCGGGGACCCCGCTCCCGG + Intronic
1163607113 19:18281509-18281531 GGCCGCGGCCACTCCCCCCCGGG - Exonic
1164738039 19:30556385-30556407 GGCTGGGGAGAGCCCACTCCAGG - Intronic
1165157301 19:33796323-33796345 GGCCGCGGCCAGGACCCTCCCGG - Intronic
1166694820 19:44846496-44846518 GGCCGGGCCCAGTCCCCTCCCGG + Intronic
1168009848 19:53521379-53521401 GGCCACGGCGGGGCCCCACCAGG - Exonic
925358932 2:3263648-3263670 GGCCGCACCGTGCCACCTCCTGG - Intronic
926988321 2:18648449-18648471 GGCCTCCCCCAGCCCCCTCCTGG + Intergenic
927125961 2:20012598-20012620 GGCCCCCGCGCGCCGCCTCCCGG - Exonic
929578689 2:43068442-43068464 GGCCCCCGCCGGCCCCCTCCAGG - Intergenic
931868303 2:66434296-66434318 GGCTGCTGCGAGCCCGCGCCGGG + Intronic
933666913 2:84971417-84971439 GGTGGCGGCGCGGCCCCTCCCGG - Exonic
935196656 2:100820299-100820321 GGGCGCGGCGAGCTCCTCCCGGG - Exonic
935237505 2:101151107-101151129 CGCCCCGGCGAGCCCCTTACCGG + Exonic
935371803 2:102355737-102355759 GGCCCGGGCGCGCCCCCTTCCGG + Intronic
938903384 2:135817372-135817394 GGCACCGGCCAGCACCCTCCCGG - Exonic
941987612 2:171523547-171523569 GGCAGCCGCGGGCCCTCTCCGGG - Intronic
941987633 2:171523628-171523650 GCCCGCGGCGAGCCAGCCCCGGG + Intronic
944547508 2:200812239-200812261 GGCCGAGGCGGGCTCCCTCTGGG + Intronic
947774604 2:232697591-232697613 GGCCGGAGGGAGCCTCCTCCTGG + Intronic
948401889 2:237691361-237691383 GGCCGCGACGACCCCCTGCCAGG - Intronic
948746297 2:240096279-240096301 CGCCCCGTCCAGCCCCCTCCTGG + Intergenic
1168795908 20:610087-610109 GGCCGCGCCGCGCCGCCTCCGGG + Exonic
1168800834 20:642446-642468 GGCCCCGCGGAGCCCCCTGCGGG + Intergenic
1169037184 20:2463088-2463110 GGCCGAGGAGCACCCCCTCCAGG - Exonic
1172118556 20:32584972-32584994 GGCCGCGGCGCGTCCCGGCCCGG - Intronic
1173672982 20:44810648-44810670 GGCCGCAGCCCGCGCCCTCCGGG - Intergenic
1174386341 20:50190446-50190468 GGCCCCGGCCCGCCCCCTGCTGG - Intergenic
1174736685 20:52972129-52972151 GGGCGCGGGGACACCCCTCCGGG - Intergenic
1178351136 21:31873659-31873681 GGCCGCGGCGAGCGCGATGCCGG + Exonic
1178707639 21:34888810-34888832 GGCGGCGGCGAGCCGCGCCCTGG - Intronic
1178992189 21:37366179-37366201 GACCGCGGTGAGAGCCCTCCAGG + Intronic
1179430445 21:41317331-41317353 GGCAGCGGCCAGCCCCTCCCTGG - Intronic
1179708028 21:43193810-43193832 GGGCCTGGCGAGGCCCCTCCTGG + Intergenic
1182445559 22:30387410-30387432 GGCCGCGGCCCCGCCCCTCCCGG - Intronic
1182472077 22:30554858-30554880 GGCCGCCCCCAGCCCCCTCCTGG - Exonic
1183050617 22:35257816-35257838 GGCGGCCGCACGCCCCCTCCCGG - Intronic
1183199118 22:36373636-36373658 CTACGCTGCGAGCCCCCTCCAGG + Intronic
1184663355 22:45975696-45975718 CCCCGAGGCGAGCCCCGTCCAGG - Intronic
1184679391 22:46061983-46062005 GGCCTCGGTGCGCCTCCTCCAGG - Intronic
1184797019 22:46738408-46738430 GGCCTCGGCCAGCCCCATCCCGG - Intergenic
1185038178 22:48490276-48490298 GGCCGCGGCGAGCCCCCTCCGGG - Intronic
1185254335 22:49823963-49823985 GGCCTCGGCCAGTGCCCTCCCGG - Exonic
954327005 3:49869311-49869333 AGCCCCGCCCAGCCCCCTCCGGG + Intronic
954809993 3:53241719-53241741 GGCCACGGCTTGCCCCCTCGGGG - Intronic
955768537 3:62368862-62368884 GGCGGCGGCCGGCCCCCTCCTGG + Intergenic
962266705 3:133949069-133949091 GGTGGAGGTGAGCCCCCTCCAGG + Intronic
964118775 3:153161891-153161913 GGGCGCGGCGGGCCGCCTCAGGG - Intergenic
967812629 3:193773495-193773517 GGCCGTGGCCAGCCCCTGCCTGG + Intergenic
968235914 3:197029896-197029918 GGCCCCGGCGCGCCCCCTGCTGG + Intergenic
968565352 4:1309706-1309728 GGCCCCGGTGAGCCCCTCCCCGG + Intronic
968820030 4:2843588-2843610 GACTGCGGCGAGCCCCTGCCGGG - Intergenic
969293489 4:6255383-6255405 GGCCTCGGAGAGCCCACTCCTGG + Intergenic
969512797 4:7629309-7629331 GGCTCCGGAGAGCCCCTTCCCGG - Intronic
969828256 4:9775306-9775328 GGCAGCTGCGAGCCTCCTCATGG + Intronic
970891042 4:21044712-21044734 GGCTGCAGCCAGACCCCTCCTGG + Intronic
971352016 4:25863184-25863206 GGCCGCCGCCACCCCCCGCCCGG + Intronic
976184233 4:82429519-82429541 GGGCCCGGCGCGCCCCCTGCCGG + Exonic
984708065 4:182862353-182862375 GGCCCAGGCGGGCCCCCTGCAGG - Intergenic
984973509 4:185210209-185210231 GGTCGCGGCCAGCCGGCTCCAGG - Intronic
985542913 5:495089-495111 GGCCACGGCGCCCCCCCACCTGG - Intronic
985706891 5:1406524-1406546 GGGCGCGGGGAGCACCCACCGGG - Intronic
988796523 5:34657062-34657084 GGCGGGGGCGAGACCCCTCTGGG + Intronic
991474383 5:67004189-67004211 GGCCGCGGCGCGACCCCAGCCGG - Intronic
992611208 5:78510047-78510069 GGCTCCGGGGAGCCCCCGCCCGG + Exonic
996442999 5:123512632-123512654 GGCCGCGGCGCCCTCCCTCCCGG + Intronic
998366657 5:141636837-141636859 GGCCGCCGCCAGCCCCTCCCCGG + Exonic
1001474470 5:172040344-172040366 GGCTGCGGCCTGCCCCCTGCTGG + Intergenic
1002447845 5:179301010-179301032 GCCGGCGGCCAGCCCCCTCCTGG + Intronic
1003175777 6:3751581-3751603 GGCCGGGGCGCGCCTCCTGCGGG - Exonic
1003624160 6:7727313-7727335 CCTCGCGGAGAGCCCCCTCCCGG + Exonic
1006366758 6:33620903-33620925 GGCCGCGGCCAGGGCGCTCCAGG + Exonic
1006366921 6:33621422-33621444 GGCCCCGCCGAGCCGCCTCCTGG + Exonic
1007264776 6:40587899-40587921 GACCGCGGAGACCGCCCTCCCGG - Intergenic
1008659552 6:53652128-53652150 GGCAGCAGCGCGCCACCTCCAGG + Exonic
1010221512 6:73452348-73452370 GGCCGCGGCCAGCCTCTTCGCGG - Intergenic
1013272497 6:108557866-108557888 GCCCGCGGCGCGGCCTCTCCGGG - Intergenic
1015440311 6:133240854-133240876 GGCCACTGCGGGCCCCCTGCCGG - Intronic
1016994917 6:149954749-149954771 GGCAGCGGCGCACCCACTCCGGG + Intergenic
1017003692 6:150014687-150014709 GGCAGCGGCGCACCCACTCCGGG - Intergenic
1018686333 6:166307511-166307533 GGCCGCCGCGCGCCTCCGCCCGG - Exonic
1023801528 7:43839086-43839108 GGTGGCCGCGTGCCCCCTCCTGG + Intergenic
1023867346 7:44244474-44244496 GGCCCCAGGGAGCCCCCTGCTGG - Intronic
1028160099 7:87475693-87475715 GGCCGCGGCGAGCAAAGTCCAGG - Exonic
1028488211 7:91383218-91383240 GGCCCCAGCGAGCACCCTTCAGG - Intergenic
1029139787 7:98401319-98401341 GGCCACGGTGCGCCCCCTCGCGG + Intergenic
1034517494 7:151592042-151592064 GGCCTGGGCGAGCCCCGTCTCGG - Intronic
1035187520 7:157138503-157138525 GGCCGCTCCCAGCCCGCTCCGGG + Intergenic
1041689893 8:60678673-60678695 GCCCGCCGCCAGCTCCCTCCGGG - Intergenic
1044934164 8:97277526-97277548 GGCCGCGGCCAGGCCCGGCCCGG - Exonic
1045259525 8:100559831-100559853 GCCCCCGGCGCGCCCCCTGCAGG + Intergenic
1045582657 8:103498809-103498831 GGCCCCGCCCCGCCCCCTCCGGG + Intergenic
1055945581 9:81688924-81688946 GGGCGTGCCGAGCCGCCTCCCGG - Exonic
1057257943 9:93566577-93566599 AGCTGCGGCGATCCCGCTCCAGG + Intergenic
1057488939 9:95507383-95507405 GGCCCCGGCGGGCCCCCGTCTGG + Intronic
1057708078 9:97412156-97412178 GGCCGCGGCGGGGCCCCTGGCGG + Exonic
1058053283 9:100427238-100427260 GGCGGCGGCGCGCCCCCGGCCGG - Intronic
1061003822 9:127917142-127917164 GGCCGCGCAGAGCCCTCCCCAGG - Intergenic
1061727477 9:132589612-132589634 GGCCGGGCAGGGCCCCCTCCCGG - Exonic
1062525041 9:136974796-136974818 GGCCCCGGCCAGCATCCTCCGGG - Intergenic
1062599761 9:137314573-137314595 GGCAGGGGCGAGGCCTCTCCAGG - Intronic
1187701493 X:21968061-21968083 GGCCTCGGCATGCCCCCTACGGG - Intronic
1191101061 X:56729268-56729290 GATGGCGGCGAGTCCCCTCCAGG - Intergenic
1199793813 X:151177411-151177433 GGCCGCGGCGAGCGGGCTCTTGG - Intronic
1200034409 X:153318722-153318744 GGCCGCTCAGAGCTCCCTCCAGG + Intergenic
1200086508 X:153609882-153609904 GGCCGCCGCGAGCCCCTCCTGGG + Intergenic