ID: 1185039139

View in Genome Browser
Species Human (GRCh38)
Location 22:48495539-48495561
Sequence GATGGAGGAGCCTCCCCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 234}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185039139_1185039148 13 Left 1185039139 22:48495539-48495561 CCATCTGGGGAGGCTCCTCCATC 0: 1
1: 0
2: 1
3: 14
4: 234
Right 1185039148 22:48495575-48495597 CCCTGGGCTCCCTGTGCCCCTGG 0: 1
1: 0
2: 5
3: 110
4: 785
1185039139_1185039142 -4 Left 1185039139 22:48495539-48495561 CCATCTGGGGAGGCTCCTCCATC 0: 1
1: 0
2: 1
3: 14
4: 234
Right 1185039142 22:48495558-48495580 CATCCTTGTTCTCCCTTCCCTGG 0: 1
1: 0
2: 2
3: 28
4: 346
1185039139_1185039143 -3 Left 1185039139 22:48495539-48495561 CCATCTGGGGAGGCTCCTCCATC 0: 1
1: 0
2: 1
3: 14
4: 234
Right 1185039143 22:48495559-48495581 ATCCTTGTTCTCCCTTCCCTGGG 0: 1
1: 1
2: 4
3: 29
4: 311
1185039139_1185039153 29 Left 1185039139 22:48495539-48495561 CCATCTGGGGAGGCTCCTCCATC 0: 1
1: 0
2: 1
3: 14
4: 234
Right 1185039153 22:48495591-48495613 CCCCTGGCCCTGCACCCAGCCGG 0: 1
1: 0
2: 3
3: 68
4: 607

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185039139 Original CRISPR GATGGAGGAGCCTCCCCAGA TGG (reversed) Intronic
900639956 1:3683945-3683967 AATGGGGGAGCCTGCCAAGATGG - Intronic
900811118 1:4802042-4802064 GATGGAGGAGCCAGAGCAGAAGG + Intergenic
902738021 1:18414057-18414079 GTGGGAGGAGCCTCCAAAGAGGG - Intergenic
903642729 1:24870971-24870993 GATGGAGATGCCGGCCCAGAGGG + Intergenic
903829914 1:26168628-26168650 GATGCACCAGCCTCCCCAGCTGG + Intergenic
904042461 1:27592645-27592667 GAAGGAGGGGGCTCCCCAGCTGG + Intronic
906077834 1:43065186-43065208 GAGGGAGGAGCGTCCCCAAAAGG + Intergenic
912272652 1:108226846-108226868 GATGAAGAACCCTCCCCAGCTGG - Exonic
912295568 1:108467476-108467498 GATGAAGAACCCTCCCCAGCTGG + Exonic
912428364 1:109614055-109614077 GCTGGCGGAGCCTCCTCAGGTGG + Exonic
914719967 1:150281823-150281845 GATGGAGGAGCCGCCCCAGCGGG + Intergenic
916117060 1:161494562-161494584 GCTGGAGGAGCCTAACCACAAGG + Intergenic
916921823 1:169477160-169477182 TATGGAGGAGCCTCCCGTGGAGG - Exonic
918480771 1:184974503-184974525 CCTGGAGGAGGCGCCCCAGAAGG - Exonic
919402782 1:197140236-197140258 GGTAGAAGAGCCTTCCCAGATGG + Intronic
1062844014 10:690541-690563 GATGCGAGGGCCTCCCCAGATGG - Intergenic
1063693893 10:8314103-8314125 GTTTGAGGAGCCTCCCCAAAAGG - Intergenic
1067757119 10:49013658-49013680 GATGGAGGAGACCCCACAAAGGG + Intergenic
1067944254 10:50680337-50680359 GATGGTGGAGCCTGCACAGGGGG + Intergenic
1069663538 10:70139630-70139652 GTTGGAGTGGGCTCCCCAGAAGG + Exonic
1076514098 10:131033485-131033507 CATGGAGAAGCCTTCACAGAAGG - Intergenic
1079127957 11:17732171-17732193 GACACAGGAGCCTCCCCAGCAGG - Intergenic
1083701939 11:64485280-64485302 GATGGAGGCGCCGCCCCACTGGG - Intergenic
1086891118 11:92259124-92259146 GATGCAGGAGCATGCTCAGAGGG - Intergenic
1088993248 11:114972877-114972899 GAGGGAGGAACATCCCAAGAAGG - Intergenic
1089776087 11:120837103-120837125 GATGGACGAGCCTCCTCAGTAGG + Intronic
1090218124 11:124989032-124989054 GATGGTGGACCCTTTCCAGAGGG + Intronic
1090254762 11:125275708-125275730 GATGGAGGAGACTTGGCAGAAGG + Intronic
1092244931 12:6858662-6858684 GAAGGAGGAGTATGCCCAGAGGG - Intronic
1093104209 12:15066143-15066165 GGTGGAGCAGCCTCCCCTCAGGG + Intergenic
1095876690 12:47087086-47087108 CATGGAGCAGCCACCACAGAGGG - Intronic
1096554702 12:52396127-52396149 GCTGGAGGAGGCTCTGCAGAAGG - Exonic
1103243209 12:119432290-119432312 GAGGGATGAGCCTCCCAAAAGGG + Intronic
1105013700 12:132773245-132773267 GATGGAGGAGCACGCCCTGACGG - Exonic
1105530205 13:21212282-21212304 GATGGGAGAGCCTGCCCTGAAGG - Intergenic
1106900822 13:34353338-34353360 GATGGAGTAGCCTGCTCAGATGG - Intergenic
1113128162 13:107003621-107003643 CTTGGAGGAGCCTCCACAGCTGG + Intergenic
1115160436 14:30387679-30387701 GTTGAGGGAGACTCCCCAGAAGG + Intergenic
1117110424 14:52447302-52447324 GATAGAGGAGCCTCACCCCATGG - Intronic
1119545396 14:75468051-75468073 GGTGGAGCGGCCTCCCCAGGGGG - Intronic
1120898584 14:89556628-89556650 AAGGGAGGAGCCTCCCAGGAGGG + Intronic
1121600669 14:95200600-95200622 GCAGGAGGAGCCTCCCCATCAGG + Intronic
1122411633 14:101528781-101528803 GAGGGGTGGGCCTCCCCAGAGGG + Intergenic
1123469260 15:20538151-20538173 GATGGAGTGTCCTGCCCAGAAGG - Intronic
1123472726 15:20566921-20566943 GATGGAGTGTCCTGCCCAGAAGG + Intergenic
1123645277 15:22433432-22433454 GATGGAGTGTCCTGCCCAGAAGG - Intergenic
1123648804 15:22462547-22462569 GATGGAGTGTCCTGCCCAGAAGG + Intronic
1123729533 15:23133138-23133160 GATGGAGTGTCCTGCCCAGAAGG - Intronic
1123733033 15:23161912-23161934 GATGGAGTGTCCTGCCCAGAAGG + Intergenic
1123747700 15:23330620-23330642 GATGGAGTGTCCTGCCCAGAAGG - Intergenic
1123751163 15:23359289-23359311 GATGGAGTGTCCTGCCCAGAAGG + Intronic
1124280068 15:28354471-28354493 GATGGAGTGTCCTGCCCAGAAGG - Intergenic
1124283538 15:28383207-28383229 GATGGAGTGTCCTGCCCAGAAGG + Intronic
1124299160 15:28528406-28528428 GATGGAGTGTCCTGCCCAGAAGG - Intronic
1124302632 15:28557140-28557162 GATGGAGTGTCCTGCCCAGAAGG + Intergenic
1124482127 15:30087764-30087786 GATGGAGTGTCCTGCCCAGAAGG + Intronic
1124488585 15:30139864-30139886 GATGGAGTGTCCTGCCCAGAAGG + Intronic
1124754943 15:32398458-32398480 GATGGAGTGTCCTGCCCAGAAGG - Intronic
1124959656 15:34384946-34384968 GATGGAGTGTCCTGCCCAGAAGG - Intronic
1124976282 15:34531167-34531189 GATGGAGTGTCCTGCCCAGAAGG - Intronic
1125726829 15:41872402-41872424 CATGGAGGAGCTTGACCAGACGG - Exonic
1129029691 15:72609277-72609299 GATGGAGTGTCCTGCCCAGAAGG + Intergenic
1129037627 15:72660309-72660331 GATGGAGTGTCCTGCCCAGAAGG + Intronic
1129212260 15:74076916-74076938 GATGGAGTGTCCTGCCCAGAAGG - Intronic
1129398137 15:75264163-75264185 GATGGAGTGTCCTGCCCAGAAGG + Intronic
1129401748 15:75288444-75288466 GATGGAGTGTCCTGCCCAGAAGG + Intronic
1129729388 15:77921234-77921256 GATGGAGTGTCCTACCCAGAAGG - Intergenic
1129839128 15:78732736-78732758 GATGGAGTGTCCTGCCCAGAAGG + Intergenic
1132201764 15:99959827-99959849 GATGCAGAAGCTTCCACAGAGGG - Intergenic
1132712637 16:1276364-1276386 GATGAGGGAGCCCCCGCAGATGG + Intergenic
1132715634 16:1288714-1288736 GATGAGGGAGCCCCCACAGATGG + Intergenic
1132869863 16:2111159-2111181 GTTGGAGGAGCCATCCCCGAAGG + Exonic
1133130863 16:3675483-3675505 CATGGAGGACCCTTCCCAGCAGG - Intronic
1133148289 16:3807112-3807134 GCTGGAGTCGGCTCCCCAGAAGG - Intronic
1133223331 16:4328477-4328499 AATGGAGGCCCCACCCCAGAGGG - Intronic
1136496385 16:30647584-30647606 GCTGCAGGAGCCTCCCAGGAGGG + Intergenic
1138009165 16:53361915-53361937 GATGGAGTGTCCTGCCCAGAAGG - Intergenic
1138050738 16:53774701-53774723 GAAGGTGGAGCCTCCAGAGATGG + Intronic
1140970480 16:80007703-80007725 GATGCAGGAGTCTACCCAGTTGG + Intergenic
1141410768 16:83831457-83831479 GATGGAGCAGCTTCTCCTGAGGG + Intergenic
1141829244 16:86500499-86500521 GCTGGTGGGGCCTCCCCAGGAGG + Intergenic
1142194483 16:88733149-88733171 GATGGAGGACTCTCCCCTGGGGG - Intronic
1142229212 16:88891836-88891858 GCTGCGGGAGCCTCCCTAGAAGG - Intronic
1142315993 16:89345360-89345382 GAGGGCAGAGCCTCCCCAGATGG - Intronic
1142668765 17:1477727-1477749 GAGGGAGGTGCCGCCCCAGTTGG - Intronic
1143411974 17:6714381-6714403 CATGGATGAGACTCCCCAAAAGG - Intergenic
1143732055 17:8886871-8886893 GATGGAGGAGGGCCCTCAGAAGG - Intronic
1144745168 17:17609176-17609198 GATGGTGGTGCCTCCCAGGAGGG + Intergenic
1145010115 17:19363128-19363150 CTCGGAGGAGCCTCCCCAGCTGG + Intronic
1145760635 17:27423556-27423578 GATGAAGGAGTCGCTCCAGAAGG + Intergenic
1145841892 17:28002037-28002059 GATGGAGGAGCTGACCCAGGAGG + Intergenic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1149576438 17:57716689-57716711 GTGGGAGGAGACTCCCAAGAGGG - Intergenic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150635261 17:66908644-66908666 GCTGGAGGAGGCTGACCAGACGG + Intergenic
1151947094 17:77325700-77325722 GCTGCAGGGGCTTCCCCAGAGGG - Intronic
1152446539 17:80348061-80348083 GACGGAGGAACTTCACCAGAAGG + Exonic
1152684036 17:81685007-81685029 GCTGGAGCTGCCCCCCCAGAGGG + Intronic
1152698655 17:81808349-81808371 GGGGGACCAGCCTCCCCAGATGG - Intronic
1152758128 17:82095604-82095626 AATGGAGCAGGCTCCCCAGGAGG + Intronic
1152850214 17:82629424-82629446 TCTGGAGGAGCCCACCCAGAAGG - Intronic
1153521189 18:5955491-5955513 GATGGTGGAGGGTCCTCAGAAGG + Exonic
1157478736 18:48039535-48039557 AATGGATGGCCCTCCCCAGATGG - Intronic
1157621962 18:49021807-49021829 CAGGGAGCAGCCTCACCAGAGGG + Intergenic
1157751120 18:50179391-50179413 GATGAAGGAACTTCCCAAGATGG - Intronic
1160968193 19:1755780-1755802 GAGGGAGGAGGGTCCCCAGGGGG - Intronic
1161596319 19:5152740-5152762 GGTGGGGAAGGCTCCCCAGAGGG - Exonic
1161849762 19:6732235-6732257 GATGGAGCAGCCTCCGGAGCAGG - Intronic
1162931376 19:13959513-13959535 GATGGAGAGGCCAGCCCAGACGG + Intronic
1164787067 19:30941926-30941948 GCTGGAGGAGCCACCCAGGATGG + Intergenic
1165000450 19:32757590-32757612 GGTGGAGGAACCACCACAGAGGG - Intronic
1165374631 19:35432996-35433018 CAGAGAGGAGCATCCCCAGAGGG + Intergenic
1166689164 19:44812527-44812549 GATGGAGGACTCTGCCCAGGAGG + Exonic
1168057051 19:53869705-53869727 GAGGGAGGAGCCTGTCCAAACGG + Intronic
1168689781 19:58369311-58369333 GATGGAGGCTCCAGCCCAGAAGG - Exonic
926129100 2:10289877-10289899 GATGGGGCAGCCCCCACAGAGGG + Intergenic
927902661 2:26832106-26832128 GATGGTGTAGCCCCTCCAGAGGG + Intergenic
927929614 2:27035753-27035775 AAAGGAGGAGGCTCCCAAGATGG - Intronic
929005221 2:37387199-37387221 GATGGAGGAGCCTGGTCATATGG - Intergenic
930026382 2:47031695-47031717 GATGGAGGGGCCCCCTCAGCTGG - Intronic
932430342 2:71670368-71670390 CATGGGGGAGCTTCCCAAGAAGG + Intronic
932434136 2:71693269-71693291 ACTGGAGGAGCCTCCCAACAAGG - Intergenic
934938535 2:98482592-98482614 AATGGAGGTGTCTCCCCAGTGGG + Intronic
936286893 2:111187896-111187918 GATGTAAGTGCATCCCCAGAGGG - Intergenic
936617707 2:114065354-114065376 GATGGAGATTCCTCCGCAGAGGG + Intergenic
938190361 2:129274082-129274104 GAAGGAAGAGCCTACCAAGAGGG + Intergenic
942493908 2:176518995-176519017 GATGCAGGGGCTTCCCCAGCAGG - Intergenic
947812034 2:233010815-233010837 ACTGGAGGACCCACCCCAGAAGG - Intronic
948665011 2:239529173-239529195 CATGGCCGAGCCTCCCCAAAAGG + Intergenic
948668426 2:239551000-239551022 GATGACGCAGCCTCCCCAGGTGG - Intergenic
948918131 2:241048627-241048649 GAGGGAGGAGCCTCCCATGTGGG - Intronic
1171123764 20:22585046-22585068 GAGGCCGGAGCCGCCCCAGAGGG - Intronic
1172623728 20:36335793-36335815 GCTGGAGAAGGCTTCCCAGAGGG - Intronic
1176115922 20:63431923-63431945 GAGGGTGGAGCCTTCCCTGAGGG - Intronic
1176116066 20:63432319-63432341 GAGGGTGGAGCCTTCCCAGAGGG - Intronic
1176116126 20:63432481-63432503 GAGGGTGGAGCCTTCCCAGAGGG - Intronic
1176116144 20:63432535-63432557 GAGGGTGGGGCCTTCCCAGAGGG - Intronic
1176116152 20:63432553-63432575 GAGGGTGGAGCCTTCCCTGAGGG - Intronic
1176116176 20:63432625-63432647 GAGGGTGGGGCCTTCCCAGAGGG - Intronic
1176116204 20:63432697-63432719 GAGGGTGGGGCCTTCCCAGAGGG - Intronic
1176116212 20:63432715-63432737 GAGGGTGGAGCCTTCCCTGAGGG - Intronic
1176116246 20:63432805-63432827 GAGGGTGGAGCCTTCCCTGAGGG - Intronic
1179524889 21:41969415-41969437 GATGGGGTAGCCTCAACAGATGG + Intergenic
1179563347 21:42231128-42231150 GAAGCTGGAGCCTCTCCAGAGGG - Intronic
1179726851 21:43345723-43345745 GAGTGAGGAGCCTCTCCGGAGGG - Intergenic
1179994225 21:44966607-44966629 GAGGGAGAGGGCTCCCCAGAGGG - Intronic
1180094635 21:45550235-45550257 GCAGGAGGCGCCTCCCCAGGAGG - Intergenic
1180183995 21:46130527-46130549 GATGAAGGATCCTCCACAGGAGG + Intronic
1180856984 22:19053734-19053756 GATGAAGGAACTTCCCCACAGGG + Intronic
1182964692 22:34510020-34510042 GTAGGTGAAGCCTCCCCAGAGGG - Intergenic
1183489610 22:38109473-38109495 GACCGAGGTGCCTCCCGAGATGG + Intronic
1184655103 22:45937122-45937144 GATGGAGGAGCCGCACTGGATGG - Intronic
1184764014 22:46562178-46562200 GGTGGAGCAGCCCCCCCAGAGGG + Intergenic
1185039139 22:48495539-48495561 GATGGAGGAGCCTCCCCAGATGG - Intronic
1185178554 22:49346170-49346192 CATGGAGGAGCCTACCCGCAAGG + Intergenic
950111832 3:10423625-10423647 CATGGAGGCCCCTCCCCAGAAGG - Intronic
950557103 3:13702542-13702564 GGTAGAGCAGCCTCCCCATATGG - Intergenic
950557382 3:13703758-13703780 GATAGATGAGCCTCCTCACATGG - Intergenic
950559579 3:13713946-13713968 GTTAGATGAGCCTCCCCAGATGG - Intergenic
950702496 3:14759941-14759963 GCAGGAGGACCCTCCCCTGATGG + Exonic
953119611 3:40026958-40026980 AATGGATGAGCCACCCTAGAGGG - Intronic
953446874 3:42975969-42975991 GATGGAGGAAACTGCCCTGAAGG + Intronic
953565730 3:44030382-44030404 GATGGACGTGCCGCCGCAGAAGG - Intergenic
958124503 3:89338365-89338387 GTTGGAAGAGACTCCACAGAAGG - Intronic
961513495 3:127418926-127418948 GAAGGAGGAGACTGCCCAGCCGG + Intergenic
962354442 3:134681591-134681613 GATGGAGGAGCCTGGCAAAAGGG + Intronic
963106961 3:141655626-141655648 GATGAAAGAGGCTTCCCAGAAGG - Intergenic
963583381 3:147154371-147154393 GGTGGACGAGCCTCCCCGAAGGG + Intergenic
969493564 4:7513361-7513383 GCTGGAAGAAGCTCCCCAGAGGG + Intronic
975985785 4:80200671-80200693 GATGAAGAAGCCTCCTCAAATGG - Intronic
978307515 4:107347941-107347963 GACTCAGGAGCCTCCCTAGAAGG - Intergenic
979519588 4:121650942-121650964 AATGGAGCAGCCTCCCCTGTGGG - Intergenic
982202827 4:152975773-152975795 GGGGCAGGAGCCTCCCCAGGGGG - Exonic
982329337 4:154164001-154164023 GGTGGAGGAGCCTCACGGGAGGG - Intergenic
983954947 4:173686503-173686525 GATGGAGGCTGCTCACCAGAAGG - Intergenic
985487157 5:158248-158270 GATGGAGGAGACCCCCAGGATGG - Intronic
985487170 5:158288-158310 GATGGAGGAGACCCCCAGGATGG - Intronic
985487183 5:158328-158350 GATGGAGGAGACCCCCAGGATGG - Intronic
985487196 5:158368-158390 GATGGAGGAGACCCCCAGGATGG - Intronic
985487218 5:158448-158470 GATGGGGGAGACTCCCAGGACGG - Intronic
985487263 5:158567-158589 GATGAAGGAGACTCCCAGGACGG - Intronic
985913560 5:2901101-2901123 TATCCAGGAGTCTCCCCAGATGG + Intergenic
986128456 5:4905219-4905241 GATGGAGGAGCGTGTGCAGATGG + Intergenic
986498529 5:8372899-8372921 GATGGAGGCGCCTCCTCCCAGGG + Intergenic
987670596 5:21002290-21002312 GATGGAGAAACATCACCAGATGG - Intergenic
989101066 5:37823625-37823647 GTTGGAGGAGCTTCCGGAGATGG - Intronic
990880671 5:60533960-60533982 TATGAAGGACCCTCACCAGATGG + Intergenic
992190733 5:74289237-74289259 GGTGGAGGAGCCTTCAGAGAAGG - Intergenic
993307901 5:86293145-86293167 GATGAAGAACCCTCCCCAGCTGG + Intergenic
995574438 5:113514164-113514186 GATGGGGGTGCCTCCGAAGAGGG + Intronic
995711994 5:115045167-115045189 GATGGTGGGGCCTCATCAGATGG + Intergenic
997582315 5:135025706-135025728 GATGGAGCCACCTCCCCAGAAGG + Intergenic
998245317 5:140496897-140496919 CATAGAGGAGTCTTCCCAGAAGG + Exonic
998446271 5:142200743-142200765 GATAGAGGAACATCCCCATATGG + Intergenic
999180592 5:149667442-149667464 ATTGGAGGAGGCTTCCCAGAGGG - Intergenic
1001697870 5:173685810-173685832 GGTGGAGGAGGCCTCCCAGAGGG - Intergenic
1002276357 5:178106849-178106871 GGTGGAGCTGCCACCCCAGATGG - Intergenic
1002420200 5:179142062-179142084 GGTGCAGGGGCCTGCCCAGAGGG + Intronic
1003921607 6:10838304-10838326 GAGGGAGGAGGGTCCCCGGAGGG - Intronic
1006441087 6:34054060-34054082 GATTGATGAGCCAGCCCAGAGGG - Intronic
1013154537 6:107480935-107480957 TATGGAGGAGCCTGGGCAGAAGG - Intergenic
1017822199 6:158057531-158057553 GATGAAGGAGCCAGCTCAGAAGG + Intronic
1019313657 7:374856-374878 CGTGAAGGAGCCTCCCCTGATGG + Intergenic
1020263913 7:6547766-6547788 GATGGAGGAGACACTCCTGAGGG + Intronic
1021093569 7:16510361-16510383 CATGGAGGATCCTCACTAGAAGG - Intronic
1024001089 7:45189775-45189797 GATGGAGCAGCCACCCGGGAGGG + Intergenic
1025038937 7:55622490-55622512 TCTGGTGGAGCTTCCCCAGAAGG + Intergenic
1026015076 7:66666181-66666203 GATGAAGGAGCCTCCTCTGCAGG + Intronic
1026679600 7:72455642-72455664 CATGGAGGAGGCTCCTGAGATGG + Intergenic
1026901057 7:74037787-74037809 GAGGGAGGAGCCTACCCAGCTGG + Intronic
1027352691 7:77327788-77327810 GTTGGAAGAGGCTCCCCAGAGGG - Intronic
1029419181 7:100463590-100463612 GATGGAGAAGACTCTCCAGGTGG - Exonic
1033114994 7:138617486-138617508 GATAGCTGTGCCTCCCCAGAGGG + Intronic
1034531217 7:151697406-151697428 GGTGGCAGAGCCTCCTCAGAGGG - Intronic
1034713901 7:153221527-153221549 GATGCTGGAGCCCCTCCAGATGG + Intergenic
1035068268 7:156123356-156123378 AAAGGAGAAGCCACCCCAGAAGG + Intergenic
1035360531 7:158310595-158310617 AATGGAGGAACCTCCCGAGCAGG - Intronic
1039428369 8:37505610-37505632 GCTGGAGGAGCCTCCCAGGCAGG - Intergenic
1041547527 8:59062271-59062293 TAAGGAGTTGCCTCCCCAGAAGG - Intronic
1041882513 8:62768101-62768123 GATGGATGCGCCTGCCCAGAGGG - Intronic
1042084976 8:65097520-65097542 GAAGGAGGAGCCACTCCAGTTGG + Intergenic
1042424328 8:68629340-68629362 GATGGAGAAGCCTGTTCAGATGG + Intronic
1042998032 8:74722249-74722271 AATGGAGCAGCCTCTGCAGAAGG + Intronic
1048140671 8:131791185-131791207 GCTAGAGGAGCCTTCACAGAGGG - Intergenic
1049374326 8:142281797-142281819 AAGGGAGGGGCCTTCCCAGATGG - Intronic
1050105123 9:2157471-2157493 AAGGGAGGAGGATCCCCAGAGGG + Intronic
1053084377 9:35205550-35205572 GTTGGAGGAACCTCCCTAGTGGG - Intronic
1057261469 9:93587178-93587200 GATGGAGGAGCCTCGGGTGAGGG + Intronic
1058863805 9:109143389-109143411 AATGGGGGAGGCTCCCCAGGGGG + Intronic
1059046721 9:110877040-110877062 GAAGTAGGAGCAACCCCAGAAGG + Intronic
1059412315 9:114140117-114140139 GAAGGACCAGCCTCTCCAGAAGG - Intergenic
1061313131 9:129777099-129777121 GATGCCGGAGTGTCCCCAGATGG + Intergenic
1061475765 9:130865024-130865046 GAAGGAGGAGACTCCAGAGAAGG + Intronic
1061984995 9:134125547-134125569 GCTGGAGGAGCATCCCACGATGG + Intergenic
1187380585 X:18798365-18798387 CATTGAGGAGGCTCCCAAGAGGG + Intronic
1187626655 X:21121998-21122020 GATGGAAAAGTCACCCCAGAGGG + Intergenic
1189377122 X:40474791-40474813 GATGTAGGAGACTGCTCAGAGGG + Intergenic
1200034498 X:153319027-153319049 GGCTGAGGAGCCTCCCCAGGAGG - Intergenic