ID: 1185039424

View in Genome Browser
Species Human (GRCh38)
Location 22:48496944-48496966
Sequence GGGGGCGCCAAGCCTCTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 116}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185039424_1185039431 -2 Left 1185039424 22:48496944-48496966 CCAGAAAGAGGCTTGGCGCCCCC 0: 1
1: 0
2: 0
3: 2
4: 116
Right 1185039431 22:48496965-48496987 CCTCACCTCCCAGCCACCAGGGG 0: 1
1: 1
2: 2
3: 88
4: 660
1185039424_1185039432 1 Left 1185039424 22:48496944-48496966 CCAGAAAGAGGCTTGGCGCCCCC 0: 1
1: 0
2: 0
3: 2
4: 116
Right 1185039432 22:48496968-48496990 CACCTCCCAGCCACCAGGGGAGG 0: 1
1: 0
2: 3
3: 46
4: 491
1185039424_1185039427 -4 Left 1185039424 22:48496944-48496966 CCAGAAAGAGGCTTGGCGCCCCC 0: 1
1: 0
2: 0
3: 2
4: 116
Right 1185039427 22:48496963-48496985 CCCCTCACCTCCCAGCCACCAGG 0: 1
1: 1
2: 5
3: 66
4: 736
1185039424_1185039436 10 Left 1185039424 22:48496944-48496966 CCAGAAAGAGGCTTGGCGCCCCC 0: 1
1: 0
2: 0
3: 2
4: 116
Right 1185039436 22:48496977-48496999 GCCACCAGGGGAGGAGCTGCTGG 0: 1
1: 0
2: 4
3: 46
4: 393
1185039424_1185039429 -3 Left 1185039424 22:48496944-48496966 CCAGAAAGAGGCTTGGCGCCCCC 0: 1
1: 0
2: 0
3: 2
4: 116
Right 1185039429 22:48496964-48496986 CCCTCACCTCCCAGCCACCAGGG 0: 1
1: 0
2: 10
3: 72
4: 616
1185039424_1185039439 15 Left 1185039424 22:48496944-48496966 CCAGAAAGAGGCTTGGCGCCCCC 0: 1
1: 0
2: 0
3: 2
4: 116
Right 1185039439 22:48496982-48497004 CAGGGGAGGAGCTGCTGGACTGG 0: 1
1: 0
2: 4
3: 43
4: 544
1185039424_1185039440 18 Left 1185039424 22:48496944-48496966 CCAGAAAGAGGCTTGGCGCCCCC 0: 1
1: 0
2: 0
3: 2
4: 116
Right 1185039440 22:48496985-48497007 GGGAGGAGCTGCTGGACTGGAGG 0: 1
1: 0
2: 4
3: 59
4: 530

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185039424 Original CRISPR GGGGGCGCCAAGCCTCTTTC TGG (reversed) Intronic
910762341 1:90746295-90746317 GGGGTCCCCAAGAGTCTTTCAGG - Intergenic
919991785 1:202712287-202712309 GGGGGCTGCAGCCCTCTTTCTGG - Intergenic
1062966341 10:1610356-1610378 AGGGGAGCAAAGCCTGTTTCTGG - Intronic
1063462632 10:6224220-6224242 GGAGGCCCCAAGCCTCATCCTGG + Intronic
1064423269 10:15208514-15208536 GAGACCACCAAGCCTCTTTCAGG + Intergenic
1065917857 10:30367572-30367594 GGGGGCTCCATGCCTCTAGCTGG + Intronic
1070789152 10:79179474-79179496 TGGGGCACCACGCCTCTTCCAGG + Intronic
1072720190 10:97775604-97775626 GGGGACCCCGAGACTCTTTCCGG + Intergenic
1073911670 10:108351965-108351987 GTGGGCTCCATGCCTCATTCAGG - Intergenic
1074727670 10:116329603-116329625 GGGGTCCCCAAGACACTTTCAGG + Intronic
1075405359 10:122192221-122192243 GGGCACACCAAGCCTCTTTGTGG - Intronic
1075901136 10:126043557-126043579 GGATGCGCCAAGCATCTGTCAGG - Intronic
1077286436 11:1768026-1768048 AGGGGCCCCAAGCTTCTCTCTGG + Intergenic
1077373621 11:2195137-2195159 GTGGACCCCCAGCCTCTTTCCGG - Intergenic
1078983153 11:16561675-16561697 GGGGTTACCAAGACTCTTTCAGG + Intronic
1079008627 11:16810482-16810504 TGGTGAGCCAAGCCTCTTCCAGG + Intronic
1079102178 11:17548464-17548486 GTGGGCACCAGGGCTCTTTCAGG + Intronic
1082811966 11:57483688-57483710 GGAGGTCCCAAGCTTCTTTCCGG - Intergenic
1083665447 11:64271708-64271730 GGAGGAGCCCAGCCCCTTTCGGG - Exonic
1085874198 11:80386472-80386494 TTGGGAGCCAAGCCTCTTTACGG - Intergenic
1091823002 12:3490637-3490659 TGGGACTCCAAGCCCCTTTCAGG - Intronic
1093077269 12:14770939-14770961 GGGGGCGTCAAGCGCATTTCTGG - Exonic
1100353501 12:93807362-93807384 GGGTGCACCAAGGCTCATTCTGG + Intronic
1102011302 12:109620174-109620196 CGGGTCCCCAAGACTCTTTCAGG + Intergenic
1111193879 13:84846313-84846335 GGGGGAGCCCAGCCTCTTTATGG - Intergenic
1117286568 14:54291382-54291404 GGGGGCCCCAGGCCTTTATCAGG - Intergenic
1117288531 14:54310338-54310360 GGGTCTGCCAAGACTCTTTCAGG - Intergenic
1118401155 14:65380664-65380686 GGGTCCTCCAAGGCTCTTTCAGG + Intergenic
1122203897 14:100138794-100138816 GGGTGGGGCAAGCCTCTGTCGGG + Intronic
1122244402 14:100391793-100391815 GGGGGCCTCAAGACCCTTTCAGG + Intronic
1123448586 15:20346361-20346383 GGAGGTGCCAAGCCTGTTTATGG + Intergenic
1124208178 15:27740938-27740960 GGGGCCTCCAAGCTTCTTGCAGG - Intergenic
1124482573 15:30090497-30090519 GGGGGCTCCATGCCTCTAGCTGG - Intronic
1124521004 15:30406712-30406734 GGGGGCTCCATGCCTCTAGCTGG + Intronic
1124537658 15:30559508-30559530 GGGGGCTCCATGCCTCTAGCTGG - Intronic
1124544114 15:30611563-30611585 GGGGGCTCCATGCCTCTAGCTGG - Intronic
1124564078 15:30798998-30799020 GGGGGCTCCATGCCTCTAGCTGG - Intergenic
1124760998 15:32448079-32448101 GGGGGCTCCATGCCTCTAGCTGG + Intronic
1124777636 15:32600984-32601006 GGGGGCTCCATGCCTCTAGCTGG - Intronic
1129029921 15:72610574-72610596 GGGGGCTCCATGCCTCTAGCTGG - Intergenic
1129728873 15:77918181-77918203 GGGGGCTCCATGCCTCTAGCTGG + Intergenic
1130259422 15:82344014-82344036 GGGGGCTCCATGCCTCTAGCTGG + Intronic
1130269255 15:82435151-82435173 GGGGGCTCCATGCCTCTAGCTGG - Intronic
1130281843 15:82525168-82525190 GGGGGCTCCATGCCTCTAGCTGG - Intergenic
1130473210 15:84241331-84241353 GGGGGCTCCATGCCTCTAGCTGG - Intronic
1130480625 15:84355396-84355418 GGGGGCTCCATGCCTCTAGCTGG - Intergenic
1130484819 15:84392832-84392854 GGGGGCTCCATGCCTCTAGCTGG - Intergenic
1130491087 15:84432363-84432385 GGGGGCTCCATGCCTCTAGCTGG + Intergenic
1130502671 15:84511163-84511185 GGGGGCTCCATGCCTCTAGCTGG + Intergenic
1130595495 15:85245921-85245943 GGGGGCTCCATGCCTCTAGCTGG - Intergenic
1130912927 15:88283352-88283374 GGGGGCTCCCAGCTTCTCTCAGG + Intergenic
1131282656 15:91033782-91033804 GGGGGCTCCATGCCTCTAGCTGG + Intergenic
1131859060 15:96632583-96632605 GGAGGAGCAAAGTCTCTTTCTGG + Intergenic
1132854432 16:2038559-2038581 TGGGGCGCCCAGCCTCTTCGTGG + Exonic
1136657089 16:31716040-31716062 GGCGTCGCCATGCCCCTTTCAGG + Intronic
1140461508 16:75143607-75143629 GGGGTCTCCAAGCCCTTTTCTGG + Intergenic
1140999318 16:80293598-80293620 GGAGTCCCCAAGTCTCTTTCAGG - Intergenic
1144047411 17:11466386-11466408 GGGGGCTGCTTGCCTCTTTCAGG - Intronic
1144107320 17:11997573-11997595 GGGGACGCCCCGCCTCTCTCTGG + Intergenic
1144423951 17:15123663-15123685 GGGTGGGACAAGCCTCTTCCTGG + Intergenic
1144783218 17:17818060-17818082 GGAGGCACCAGGTCTCTTTCAGG + Intronic
1146402467 17:32510710-32510732 GGGGTCGCCAGGCCTCTCCCGGG - Intronic
1148460559 17:47837002-47837024 GGGGCCACCAAAGCTCTTTCTGG + Exonic
1148690442 17:49524030-49524052 CAGGGCGCCCAGCCTGTTTCTGG - Intergenic
1149778587 17:59378197-59378219 GGGGGAACTAAGCCACTTTCAGG - Intronic
1151369824 17:73640750-73640772 GGGGGTTCCAGTCCTCTTTCAGG + Intronic
1152496951 17:80679985-80680007 GGGGGCTCCATCCCTCTCTCTGG - Intronic
1152749134 17:82054538-82054560 GGGGGCTCCACGCCGCTCTCAGG - Exonic
1160158365 18:76451231-76451253 GGGGGAGCCAGGGCTGTTTCGGG - Intronic
1161395781 19:4044174-4044196 GGGGTCCCCCAGCCTCTTCCAGG - Intergenic
1161568583 19:5017233-5017255 GGTGGAGCCCAGCCTCTTTTGGG + Intronic
1163603784 19:18263572-18263594 GGGGGCCCCAAGTCCCTTGCAGG - Intronic
1163769248 19:19180704-19180726 GGGGGCCCCGAGTCTCTTCCAGG + Exonic
1165725614 19:38110543-38110565 TGGGGAGCCATGCCCCTTTCTGG - Intronic
1167454731 19:49592145-49592167 GGGGGCGCGAACCCCCTCTCAGG + Intronic
947199455 2:227601583-227601605 TGGGGCGCCAGAGCTCTTTCAGG + Intergenic
1170044456 20:12070961-12070983 GGGGGCAGCCAGGCTCTTTCAGG - Intergenic
1170305731 20:14935679-14935701 TGGGTGGCCAAGCCTCCTTCTGG + Intronic
1170629801 20:18057055-18057077 GGGTGCTCGGAGCCTCTTTCCGG + Intronic
1176010048 20:62888386-62888408 TGGGGCGCCAGGTCTCCTTCAGG + Intronic
1179148335 21:38788571-38788593 GGGGTCCCTGAGCCTCTTTCTGG + Intergenic
1179876040 21:44268034-44268056 GGGTGCGTGAAGCCTCTTCCCGG + Intergenic
1182437811 22:30341829-30341851 GGGGGCCCGAATCCTCATTCAGG - Exonic
1184724451 22:46335541-46335563 CGGGGCGCCGAGACTCTGTCGGG - Exonic
1185039424 22:48496944-48496966 GGGGGCGCCAAGCCTCTTTCTGG - Intronic
951603504 3:24403451-24403473 GGGGACTCCAAGCCTCTTGTAGG + Intronic
953377946 3:42444670-42444692 GGGGGCTCCAACCCTACTTCCGG - Intergenic
964444733 3:156746839-156746861 GGGGAGGCCAAGCCTACTTCAGG + Intergenic
992816576 5:80446606-80446628 GGGGTCCCCAAGACACTTTCAGG - Intronic
993476341 5:88370059-88370081 GGGGGCCCCAAACCAGTTTCAGG - Intergenic
999143322 5:149377054-149377076 GGGAGAGCCAAGTCTCTATCTGG + Intronic
999924566 5:156360875-156360897 GTGGGCGCCAAGCCCTTGTCTGG - Intronic
1005473922 6:26188931-26188953 GGCGGCGTCAAGCGTATTTCTGG - Exonic
1007363451 6:41374140-41374162 GGGGGCGCCTAGCCAGTTGCAGG + Intergenic
1015964349 6:138683133-138683155 GGGGAAGCCAGGCCTGTTTCCGG - Intronic
1021265652 7:18518281-18518303 GGGCTCTCCAAGTCTCTTTCTGG - Intronic
1027265394 7:76492373-76492395 GGGGGAGCAGTGCCTCTTTCTGG + Intronic
1027316765 7:76990490-76990512 GGGGGAGCAGTGCCTCTTTCTGG + Intergenic
1029711492 7:102302400-102302422 GGGGATGCCAGGCTTCTTTCTGG + Intronic
1033001560 7:137510813-137510835 AGGGGCCCCAAGCCTCTTTTGGG + Intronic
1039222522 8:35350088-35350110 GGGGTTCCCAAGACTCTTTCGGG - Intronic
1040566729 8:48573984-48574006 TGGGGCCACAAGCCTCTTTGGGG + Intergenic
1048174566 8:132140217-132140239 GGGGTCCCCAAGCCTTTTCCAGG - Intronic
1060817591 9:126643296-126643318 GGGAGCGCCAACTCTCTTTGAGG + Intronic
1061990261 9:134154836-134154858 GGGGCCTCCAAGGCCCTTTCTGG + Intronic
1062434647 9:136541560-136541582 GGGGGAGCCAGGCCTCCTGCAGG + Intronic
1062615208 9:137393131-137393153 GGGGGCGCCGAGGCTGTTCCAGG + Intronic
1185782629 X:2862439-2862461 GGGGGAGCCAGAGCTCTTTCAGG + Intronic
1186410528 X:9342070-9342092 GGCGCCACCCAGCCTCTTTCCGG - Intergenic
1186672570 X:11781993-11782015 GAGGGAGGCAAGTCTCTTTCAGG + Intergenic
1199607394 X:149587089-149587111 GGGGGGGCCCAGCCTCCCTCAGG + Intronic
1199631729 X:149782278-149782300 GGGGGGGCCCAGCCTCCCTCAGG - Intronic
1202266335 Y:23022641-23022663 GGGTGGGCCACCCCTCTTTCTGG + Intergenic
1202367149 Y:24173218-24173240 GGGGGCTCCATGCCTCTAGCTGG - Intergenic
1202373279 Y:24212455-24212477 GGGGGCTCCATGCCTCTAGCTGG + Intergenic
1202419328 Y:24656384-24656406 GGGTGGGCCACCCCTCTTTCTGG + Intergenic
1202451458 Y:25013700-25013722 GGGTGGGCCACCCCTCTTTCTGG - Intergenic
1202497503 Y:25457665-25457687 GGGGGCTCCATGCCTCTAGCTGG - Intergenic
1202503632 Y:25496905-25496927 GGGGGCTCCATGCCTCTAGCTGG + Intergenic