ID: 1185039498

View in Genome Browser
Species Human (GRCh38)
Location 22:48497176-48497198
Sequence CACCGCAGGCGGGGGCGGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 160}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185039498_1185039519 29 Left 1185039498 22:48497176-48497198 CCGTTCCGCCCCCGCCTGCGGTG 0: 1
1: 0
2: 2
3: 13
4: 160
Right 1185039519 22:48497228-48497250 TGGGCGGACCTTGCCCTGGGTGG 0: 1
1: 0
2: 5
3: 21
4: 147
1185039498_1185039517 25 Left 1185039498 22:48497176-48497198 CCGTTCCGCCCCCGCCTGCGGTG 0: 1
1: 0
2: 2
3: 13
4: 160
Right 1185039517 22:48497224-48497246 CGTATGGGCGGACCTTGCCCTGG 0: 1
1: 0
2: 0
3: 4
4: 31
1185039498_1185039518 26 Left 1185039498 22:48497176-48497198 CCGTTCCGCCCCCGCCTGCGGTG 0: 1
1: 0
2: 2
3: 13
4: 160
Right 1185039518 22:48497225-48497247 GTATGGGCGGACCTTGCCCTGGG No data
1185039498_1185039511 13 Left 1185039498 22:48497176-48497198 CCGTTCCGCCCCCGCCTGCGGTG 0: 1
1: 0
2: 2
3: 13
4: 160
Right 1185039511 22:48497212-48497234 CTCCCTCCTTCCCGTATGGGCGG 0: 1
1: 0
2: 0
3: 22
4: 130
1185039498_1185039508 9 Left 1185039498 22:48497176-48497198 CCGTTCCGCCCCCGCCTGCGGTG 0: 1
1: 0
2: 2
3: 13
4: 160
Right 1185039508 22:48497208-48497230 GCGCCTCCCTCCTTCCCGTATGG No data
1185039498_1185039509 10 Left 1185039498 22:48497176-48497198 CCGTTCCGCCCCCGCCTGCGGTG 0: 1
1: 0
2: 2
3: 13
4: 160
Right 1185039509 22:48497209-48497231 CGCCTCCCTCCTTCCCGTATGGG 0: 1
1: 0
2: 0
3: 8
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185039498 Original CRISPR CACCGCAGGCGGGGGCGGAA CGG (reversed) Intronic
900513426 1:3070603-3070625 CCCCGGAGGCGCGGACGGAACGG - Intronic
900646042 1:3709146-3709168 AACCGCAGGTGGGGGCGGGCGGG - Intronic
901486888 1:9569762-9569784 CAAGGCAGGGGGTGGCGGAAGGG + Intronic
901529326 1:9843479-9843501 CACTGCAGGGGGGGGTGGATGGG + Intergenic
903012892 1:20343464-20343486 CACCGGGGGCGGGTGGGGAAGGG - Intronic
903389520 1:22954057-22954079 CAGCGCGGGCGGGTGAGGAAGGG - Intronic
904751124 1:32741935-32741957 CATGGCAGGCGGGGGCGGAGCGG - Exonic
905449004 1:38045433-38045455 CGCCGCCGGCGGGGGCGGTGGGG + Exonic
905670870 1:39789138-39789160 CACCACTGGCGGGACCGGAAGGG - Intergenic
906146918 1:43565791-43565813 CCACCCAGGCGGGGGCGGGAAGG + Intronic
906197260 1:43936732-43936754 AGCCGCAGGCGGTGGCGGAGAGG - Exonic
907091611 1:51730105-51730127 CACCCCAGGGGGCGGCGGGAAGG - Intronic
907444668 1:54499910-54499932 CAGGGGAGGAGGGGGCGGAAAGG - Intergenic
908119315 1:60970979-60971001 CACAGCAGCTGGGGGCGGCAGGG - Intronic
908790740 1:67778958-67778980 CACAGCAGGTGGGGTCGAAAAGG + Intronic
917236002 1:172892627-172892649 CACTGCAGGTGGGGGTGGAATGG - Intergenic
918341989 1:183575431-183575453 CACCTCAGGTGGGGGGGGAATGG + Intronic
920002919 1:202811597-202811619 GACCGGAGGCCAGGGCGGAAGGG - Intergenic
920071790 1:203307440-203307462 CGCCCAGGGCGGGGGCGGAAGGG - Exonic
922388676 1:225114837-225114859 CACCACAGGGGGTGGGGGAAGGG + Intronic
1062936830 10:1396523-1396545 CACTGCAGGCGGGGATGGCAGGG - Intronic
1066429353 10:35336916-35336938 CGCCACGGGAGGGGGCGGAACGG - Exonic
1067140023 10:43648854-43648876 CAGCGCCGGCGCCGGCGGAATGG + Intronic
1067917638 10:50418153-50418175 CAGCCCTGGCGCGGGCGGAAAGG + Intronic
1068688173 10:59890169-59890191 CACTGCAGGCTGGCGAGGAAAGG + Intronic
1070305092 10:75235013-75235035 AGCCCCAGGCGGGGGCGCAACGG - Intronic
1073582516 10:104681332-104681354 CACTGCAGGCAGGGGCGGGCGGG - Intronic
1075768780 10:124916672-124916694 GACCGCAGTCGGCCGCGGAAAGG + Intergenic
1076020207 10:127066212-127066234 CACCGCAGCTGGGGGCGGCGGGG - Intronic
1076668560 10:132106451-132106473 CATGGCAGGAGGGGGAGGAACGG - Intronic
1077184423 11:1229916-1229938 CACCGCAGGCGGAGGCTGGTGGG - Intronic
1078426274 11:11253659-11253681 CACTGCAGGCAGGAGAGGAAAGG + Intergenic
1083856082 11:65393815-65393837 CACCCCTGGCAGGGGAGGAAGGG + Intronic
1084547806 11:69823021-69823043 CCCCGCAGGCAGGGGTGGGATGG + Intergenic
1084674852 11:70628369-70628391 CACCAAAGTCGGGGGCGGAGAGG + Intronic
1085561139 11:77473759-77473781 CGACGCGGGCGGGGGGGGAAGGG + Exonic
1085574372 11:77589552-77589574 CACCGCCCGCAGGGGCGCAAGGG + Intronic
1088869007 11:113875599-113875621 CGCTGCGGGCGGGGGCGGGACGG - Intergenic
1089132729 11:116224933-116224955 CCCCGCAGGAGGGGGAGAAAAGG + Intergenic
1089599495 11:119604811-119604833 CACTGCAGCCTGGGGTGGAATGG + Intergenic
1091916224 12:4273141-4273163 CTCTGCAGGGGGGGGCAGAAGGG + Intergenic
1103856088 12:123972460-123972482 CAGCGCCGGCGGGGGCGGAGGGG - Intronic
1104070945 12:125344915-125344937 CATCTCTGGCGGCGGCGGAATGG - Intronic
1105237224 13:18568165-18568187 CAGCGCAGGGGGGCGCTGAAGGG + Intergenic
1106269319 13:28138582-28138604 CACCATAGACGGGGGAGGAAAGG - Exonic
1107259449 13:38472880-38472902 CAGTGCAGTCGGGGGCTGAAGGG + Intergenic
1107945777 13:45416661-45416683 CTCCGCAGGCTGAGGTGGAAGGG + Intronic
1121595278 14:95157430-95157452 CTCCGCAGGCGCCGGCGGGAGGG - Intronic
1121910033 14:97781804-97781826 CACCCCAGGCTGAGGAGGAATGG + Intergenic
1122349124 14:101077581-101077603 CCCGGCAGGCGGGGGCGGAGTGG + Intergenic
1122883204 14:104699305-104699327 CAATGGAGGCGGGGGAGGAAAGG + Intronic
1123034663 14:105466995-105467017 CAGCGCAGGCAGGGGCGCCAGGG - Intronic
1123182004 14:106480213-106480235 ACCCGCGGGCGGTGGCGGAAGGG + Intergenic
1202944901 14_KI270726v1_random:16517-16539 ACCCGCGGGCGGTGGCGGAAGGG - Intergenic
1123909733 15:24955280-24955302 CACCACAGTTGGGGGCGGATGGG - Intronic
1124637012 15:31371813-31371835 CATCCCAGGCGTGGGCGGGAGGG + Intronic
1126163470 15:45634767-45634789 CCCCGCAGGCTGGGGCGCACAGG - Exonic
1128061199 15:64736973-64736995 CAGGGCAGGGTGGGGCGGAACGG + Intergenic
1129252471 15:74316476-74316498 CACAGCAGGCAGGGGAGGACAGG + Intronic
1130984278 15:88834469-88834491 CACCGCCGGCTGGGGCTGGATGG - Intronic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1131338784 15:91576244-91576266 CTCCGAAGGAGGGGGCAGAAGGG - Intergenic
1131969236 15:97875648-97875670 CAGCGCAGCCGCGGGCTGAAGGG - Intergenic
1132893273 16:2214905-2214927 CGCGGGAGGCGGGGGCGGATTGG - Intergenic
1133259428 16:4538564-4538586 CGCCGCGGGCGGGGGCGGGGAGG + Intronic
1136696529 16:32085525-32085547 CCGCGGCGGCGGGGGCGGAAAGG + Intergenic
1136797027 16:33028799-33028821 CCGCGGCGGCGGGGGCGGAAAGG + Intergenic
1138091244 16:54176500-54176522 CAGCGCAGGCGGGCGCTGGAGGG - Intergenic
1138507694 16:57486377-57486399 CGCGGCTGGCGGGGGCGGCAGGG + Exonic
1139847558 16:69931737-69931759 CACAGCAGGCAGGGGCGGGAGGG - Intronic
1140749700 16:78012062-78012084 CACCGCAGGCTGTGCTGGAATGG - Intergenic
1141174570 16:81710430-81710452 CACGCCAGGTGGGGGCGGGAGGG - Exonic
1141688311 16:85582628-85582650 CACCCCAGGCGGCTGCGTAAGGG - Intergenic
1142029935 16:87833408-87833430 CACAGCAGGCAGGGCCGGAGGGG + Intronic
1142174361 16:88638436-88638458 CACAGCAGGCGGGGGCTGCGGGG + Intergenic
1144703934 17:17355234-17355256 CACAGCAGCCCGGGGCGTAAGGG - Intergenic
1144785245 17:17827775-17827797 CCCCACAGGCTGGGGCTGAAGGG - Intronic
1144909905 17:18672501-18672523 CGCCGCAGCCGGGGGCGGCTGGG - Intronic
1145747785 17:27332922-27332944 TAGCCCAGGCGGGGTCGGAAGGG - Intergenic
1147311680 17:39599413-39599435 GACCGCAGGCGGAGGCAGGAGGG - Intergenic
1147312576 17:39604185-39604207 CACCCCAGGAGGGGACAGAATGG + Intronic
1147466142 17:40612775-40612797 CACTGGAGGCGGGTGCTGAAAGG - Intergenic
1150133317 17:62680722-62680744 CCCCGGAGGCGGGCGCGGCAGGG - Intronic
1153878293 18:9396571-9396593 GACCACATGAGGGGGCGGAATGG - Intronic
1161698335 19:5782534-5782556 CACTGCAGGCAGGGCGGGAAGGG - Intergenic
1163484503 19:17577870-17577892 CGCCGCAGGGGGTGGTGGAATGG + Intronic
1163632624 19:18425083-18425105 GACAGCAGGAGGGGGCGGAGAGG + Intronic
1165459535 19:35936512-35936534 CAGCGCAGGCGGGGGCGCAGGGG - Intronic
1166294187 19:41880995-41881017 CACAGCAGGCGGGGGCAGCCTGG - Exonic
1166726974 19:45034388-45034410 CACCCCAGGCTGGGGAGGAAGGG + Intronic
926195223 2:10759614-10759636 CACCCCAGGCAGGGGAGGCAAGG + Intronic
932786027 2:74604588-74604610 CACAGCAGGAGGGGAGGGAAGGG - Intronic
938512553 2:131966348-131966370 CAGCGCAGCGGGGGGCTGAAGGG - Intergenic
943060600 2:183038342-183038364 CGCCGGGGGTGGGGGCGGAAGGG - Exonic
945119371 2:206442911-206442933 CGCCGCAGGCTGGCGCGGAGTGG - Intergenic
947860497 2:233354477-233354499 CACCGCGGGCGGGGGCGGGGCGG - Intergenic
949075363 2:242054338-242054360 CACCTCAGGCAGGGGTGGAGGGG + Intergenic
1170998617 20:21391523-21391545 CCTCGCAGCCGGGGGCGGGATGG + Intergenic
1172820733 20:37731577-37731599 CACCAGAGGCTGGGGAGGAAGGG - Intronic
1173557182 20:43974317-43974339 CACTGCAGGCGGGGGCCCCAGGG + Intronic
1174606839 20:51767740-51767762 CACCCCGGGCGGAGGGGGAAGGG + Intronic
1175232183 20:57481018-57481040 CCCCGCAAGTGGGGGAGGAAGGG + Intergenic
1175924585 20:62465584-62465606 CACCGCAGGCGTGGGTGGTGTGG + Intronic
1176038052 20:63049913-63049935 CAGCGCAGGCCAGGGCGGAGGGG - Intergenic
1176077404 20:63254624-63254646 GGCCGCAGGCGGGGGTGGGAGGG - Intronic
1176131759 20:63499295-63499317 CGCCGCGGGCGGGGGCGGGGCGG + Exonic
1176547026 21:8206540-8206562 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1176554931 21:8250749-8250771 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1176565977 21:8389587-8389609 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1176573852 21:8433774-8433796 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1176781209 21:13196447-13196469 CAGCGCAGGGGGGCGCTGAAGGG + Intergenic
1177834017 21:26170422-26170444 GTCCGCAAGCGGGGGCGGAGAGG + Intronic
1178337323 21:31755032-31755054 CTCCGGAGGCTGAGGCGGAAAGG - Intergenic
1179887905 21:44322260-44322282 CCCTGCAGGTGGGGGCGGCAAGG + Intronic
1180165240 21:46022402-46022424 CACCGCTGGCTGGAGCAGAACGG - Intergenic
1183058664 22:35322182-35322204 CACTGCAGGCGGATGCAGAATGG + Intronic
1184233602 22:43171447-43171469 CAGGGCAGGCGGGGGCGGGGAGG - Intronic
1184689735 22:46112108-46112130 CACTGCAGGAGGTGGCGGGAAGG - Intronic
1185039498 22:48497176-48497198 CACCGCAGGCGGGGGCGGAACGG - Intronic
1203251901 22_KI270733v1_random:122825-122847 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1203259952 22_KI270733v1_random:167908-167930 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
950008211 3:9704728-9704750 CACTGCAGGTGGGGGCGGGGAGG - Exonic
950568841 3:13787725-13787747 CCCTGCAGCGGGGGGCGGAAGGG + Intergenic
953679220 3:45027103-45027125 CACTGCAGGCGGGGCTGCAAGGG - Intronic
957555629 3:81761700-81761722 CCCCGCTGGCGGGGGGAGAAAGG - Exonic
959565102 3:107825907-107825929 CAGAGCAGGCGGGGGTGGAGTGG - Intergenic
962809005 3:138946188-138946210 CGCCGCAGGCGGGTGCGGCGTGG - Exonic
964129640 3:153272564-153272586 CAGAGCAGGAGGGGGCGGAGGGG - Intergenic
967849551 3:194071415-194071437 CACGCCCGGCGGGGGCGGAGGGG + Intergenic
968582905 4:1403168-1403190 GACCGGCGGCGGGGGCGGACCGG - Exonic
968625132 4:1623551-1623573 CACCGCAGGAGGGGCCGGCCAGG - Intronic
969622855 4:8287337-8287359 CACCACAGGCCTGGGAGGAAAGG + Intronic
971154181 4:24064444-24064466 CACCACAGGCTGAGGGGGAAAGG + Intergenic
974016872 4:56656110-56656132 CACCGCTGGAGGGGGCGGCCTGG - Intronic
975986166 4:80202875-80202897 CACCAGCGGTGGGGGCGGAACGG + Exonic
978126960 4:105146604-105146626 CGGCGCAGGCCGGGGCGGAGCGG + Exonic
980942998 4:139292858-139292880 CACCCCAGGCTGGAGTGGAATGG + Intronic
982224471 4:153153327-153153349 GACCGGTGGCGGGGACGGAAAGG + Intronic
982773634 4:159420811-159420833 CAGCGCAGTGGGGGGCTGAAGGG - Intergenic
985541268 5:488769-488791 CACCGCATGCTGGGGAGGGATGG + Intronic
996790708 5:127290505-127290527 CACCGCAGGGGGTGACCGAAGGG - Intergenic
997329269 5:133047457-133047479 CAGCGCAGGGGCGGGCTGAAGGG - Intergenic
1002021379 5:176366127-176366149 GACCGCAGGCGGGAGGGGATGGG - Intronic
1002534023 5:179866287-179866309 CACAGCAGGCGCGGGTGGAAGGG - Intronic
1002638326 5:180618977-180618999 CGCCGCGGGCGGCGGGGGAATGG - Intronic
1007691631 6:43705794-43705816 CTCAGGAGGCTGGGGCGGAAGGG - Intergenic
1013273409 6:108561612-108561634 CGCCGCAGCCGGGGGCGGCTGGG + Exonic
1015994984 6:138988089-138988111 CTCCGGAGGCGTGGACGGAAGGG - Exonic
1016982292 6:149864279-149864301 CGCCGCAGGCCGGGGCGGAGAGG - Intergenic
1017810676 6:157981660-157981682 CCCCGCAGGCGGGCGTGGAGCGG - Intergenic
1018156787 6:160992198-160992220 CTCTGCAGGCTGGGGCGGGAGGG + Intronic
1019219578 6:170463377-170463399 CTCAGCAGGCAGGGGCGGGAGGG + Intergenic
1019393759 7:805373-805395 AACCCCAGGCGGGGGCAGAGCGG - Intergenic
1029546606 7:101213412-101213434 CACCGCAGCTGGGCGAGGAAGGG + Intronic
1029563927 7:101322254-101322276 GACTCCAGGAGGGGGCGGAATGG + Intergenic
1035247823 7:157576478-157576500 CGCCGCAGGGGGGAGGGGAAGGG - Intronic
1035373119 7:158391786-158391808 TACCGGGGGCGGGGGAGGAAAGG + Intronic
1039212818 8:35235802-35235824 CACCGCAGGCGGCGGCGGAGGGG + Exonic
1043296214 8:78666292-78666314 CTCCGGAGGCTGGGGCCGAAGGG + Intronic
1049055997 8:140238105-140238127 CACCGCCAGCCTGGGCGGAAAGG + Intronic
1049507920 8:143013734-143013756 CAGGGCAGGCTGGGGCGGGACGG - Intergenic
1049761468 8:144333766-144333788 CGCCGGAGGCGGGGGCGGGGCGG - Exonic
1049812402 8:144581410-144581432 CACAGCAGTCAGGGGCGGACTGG - Intronic
1051892626 9:21959163-21959185 CAGTGCAGGTGGGGGCTGAAGGG - Intronic
1057997083 9:99828488-99828510 CCCCGCAGGCGGGGGCGTTATGG + Exonic
1062488148 9:136791323-136791345 CTGCGCAGGCGCAGGCGGAAGGG - Intergenic
1203468303 Un_GL000220v1:105976-105998 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1203476124 Un_GL000220v1:149948-149970 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1185497025 X:563124-563146 CACCGCAGGCTGGGGTGCAGTGG + Intergenic
1185621502 X:1453441-1453463 CGCCGCAGGCGGGGTGGGGAGGG - Intronic
1185736683 X:2501036-2501058 CCCCGCAGGCCGGGGCGGTTCGG - Intronic
1187257766 X:17657227-17657249 CCCCGCAGGGGGGTGAGGAAGGG - Intronic
1190082361 X:47366346-47366368 CACAGAAGGCGGGGGCGAGAGGG - Intergenic
1192313116 X:70032641-70032663 CACCCCAGGCAGGGGTGGAGGGG - Intronic
1192561545 X:72131148-72131170 CAGCGCCGGCGGGGGCGGGATGG + Exonic
1194383607 X:93225036-93225058 CACCGCAGGCGGAGGCGGAGGGG + Intergenic