ID: 1185039927

View in Genome Browser
Species Human (GRCh38)
Location 22:48498617-48498639
Sequence GGTTTCTCAGGGCAGCACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185039920_1185039927 -4 Left 1185039920 22:48498598-48498620 CCAATTTCTCCCAGTTCAGGGTT No data
Right 1185039927 22:48498617-48498639 GGTTTCTCAGGGCAGCACTGGGG No data
1185039916_1185039927 30 Left 1185039916 22:48498564-48498586 CCCAATCTTTGTTCTCGTTAAAG No data
Right 1185039927 22:48498617-48498639 GGTTTCTCAGGGCAGCACTGGGG No data
1185039917_1185039927 29 Left 1185039917 22:48498565-48498587 CCAATCTTTGTTCTCGTTAAAGT No data
Right 1185039927 22:48498617-48498639 GGTTTCTCAGGGCAGCACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185039927 Original CRISPR GGTTTCTCAGGGCAGCACTG GGG Intronic