ID: 1185043754

View in Genome Browser
Species Human (GRCh38)
Location 22:48518613-48518635
Sequence TCTGAGAGAGTCCGCCTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185043754_1185043764 12 Left 1185043754 22:48518613-48518635 CCTGGGAGGCGGACTCTCTCAGA No data
Right 1185043764 22:48518648-48518670 AGCAGGGAGGGCTGACCGAGGGG 0: 1
1: 0
2: 1
3: 16
4: 220
1185043754_1185043758 -5 Left 1185043754 22:48518613-48518635 CCTGGGAGGCGGACTCTCTCAGA No data
Right 1185043758 22:48518631-48518653 TCAGAGCAGGGGTGCTCAGCAGG 0: 1
1: 0
2: 0
3: 36
4: 349
1185043754_1185043763 11 Left 1185043754 22:48518613-48518635 CCTGGGAGGCGGACTCTCTCAGA No data
Right 1185043763 22:48518647-48518669 CAGCAGGGAGGGCTGACCGAGGG 0: 1
1: 0
2: 1
3: 23
4: 246
1185043754_1185043762 10 Left 1185043754 22:48518613-48518635 CCTGGGAGGCGGACTCTCTCAGA No data
Right 1185043762 22:48518646-48518668 TCAGCAGGGAGGGCTGACCGAGG 0: 1
1: 0
2: 0
3: 27
4: 224
1185043754_1185043760 -1 Left 1185043754 22:48518613-48518635 CCTGGGAGGCGGACTCTCTCAGA No data
Right 1185043760 22:48518635-48518657 AGCAGGGGTGCTCAGCAGGGAGG 0: 1
1: 1
2: 5
3: 36
4: 344
1185043754_1185043759 -4 Left 1185043754 22:48518613-48518635 CCTGGGAGGCGGACTCTCTCAGA No data
Right 1185043759 22:48518632-48518654 CAGAGCAGGGGTGCTCAGCAGGG 0: 1
1: 0
2: 5
3: 32
4: 393
1185043754_1185043761 0 Left 1185043754 22:48518613-48518635 CCTGGGAGGCGGACTCTCTCAGA No data
Right 1185043761 22:48518636-48518658 GCAGGGGTGCTCAGCAGGGAGGG 0: 1
1: 0
2: 5
3: 47
4: 524

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185043754 Original CRISPR TCTGAGAGAGTCCGCCTCCC AGG (reversed) Intronic
No off target data available for this crispr