ID: 1185045247

View in Genome Browser
Species Human (GRCh38)
Location 22:48525407-48525429
Sequence TGGAATCGGAGTCCAGCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185045247_1185045252 14 Left 1185045247 22:48525407-48525429 CCGCCTGCTGGACTCCGATTCCA No data
Right 1185045252 22:48525444-48525466 CTGCCACCTGCTCCGCCTTCTGG 0: 1
1: 0
2: 4
3: 78
4: 463

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185045247 Original CRISPR TGGAATCGGAGTCCAGCAGG CGG (reversed) Intronic
No off target data available for this crispr