ID: 1185045834

View in Genome Browser
Species Human (GRCh38)
Location 22:48528339-48528361
Sequence CCCAGAGCAGAACCCTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 232}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185045834_1185045844 21 Left 1185045834 22:48528339-48528361 CCAGGAAAGGGTTCTGCTCTGGG 0: 1
1: 0
2: 1
3: 21
4: 232
Right 1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG 0: 1
1: 0
2: 0
3: 6
4: 89
1185045834_1185045842 10 Left 1185045834 22:48528339-48528361 CCAGGAAAGGGTTCTGCTCTGGG 0: 1
1: 0
2: 1
3: 21
4: 232
Right 1185045842 22:48528372-48528394 CCGATGCCTGTGTATAGCCAAGG 0: 1
1: 0
2: 0
3: 7
4: 64
1185045834_1185045845 24 Left 1185045834 22:48528339-48528361 CCAGGAAAGGGTTCTGCTCTGGG 0: 1
1: 0
2: 1
3: 21
4: 232
Right 1185045845 22:48528386-48528408 TAGCCAAGGCCATAGTGAGGAGG 0: 1
1: 0
2: 1
3: 10
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185045834 Original CRISPR CCCAGAGCAGAACCCTTTCC TGG (reversed) Intronic
900506174 1:3030729-3030751 CCCAGAGCAGTGCCCCTCCCCGG + Intergenic
901088511 1:6626333-6626355 CCCCGAGAAGAACCCCTACCTGG + Intronic
901228047 1:7625785-7625807 CCCAGAGCACATGCCTTTGCAGG - Intronic
901378746 1:8858591-8858613 CCCAGATACTAACCCTTTCCAGG - Intergenic
903161552 1:21492576-21492598 CCCAGAGTAGAAAACTCTCCAGG + Intergenic
904873088 1:33634043-33634065 CCCAGAGCAGAATCCTTGGTAGG - Intronic
908767344 1:67566025-67566047 CCCTGAGCACATCCCTTCCCTGG + Intergenic
911092416 1:94028372-94028394 CTCTGAGCAGCACCCTGTCCTGG - Intronic
912658478 1:111508147-111508169 CCCAGAGCAGCTCCCCTTCGTGG - Intronic
913958547 1:143322934-143322956 CCCAGACCCAGACCCTTTCCTGG - Intergenic
914052864 1:144148314-144148336 CCCAGACCCAGACCCTTTCCTGG - Intergenic
914126333 1:144818227-144818249 CCCAGACCCAGACCCTTTCCTGG + Intergenic
917320331 1:173774469-173774491 CCAAAAGCAGAACATTTTCCTGG + Intronic
921134361 1:212246875-212246897 AACAGAACAGAACCCTATCCAGG - Intergenic
921315280 1:213884595-213884617 ACCAGAGCACATTCCTTTCCTGG + Intergenic
924094192 1:240534350-240534372 CTTAGAGCAGAACCCTTTCAGGG - Intronic
1066137413 10:32463810-32463832 CCCAGAACAGAAGACTTTCATGG + Intronic
1067930080 10:50551891-50551913 CCCTGATCAAAACCCTTTCATGG + Intronic
1071417474 10:85454693-85454715 CCCAGAGAAGCTCCCTTTTCTGG + Intergenic
1074712333 10:116187863-116187885 CCCAGAGCAGAGCCCTGGCCAGG + Intronic
1075658173 10:124175384-124175406 CCCTGAGCAGGTCCCTTCCCGGG - Intergenic
1076362195 10:129897207-129897229 GGAAGAGCAGAACCCCTTCCTGG - Intronic
1076398738 10:130162759-130162781 CCCAGTGCAGCACACTTCCCAGG - Intronic
1076720382 10:132389807-132389829 CCGAGAGCAGAGCCCTGTGCTGG - Intergenic
1076729129 10:132429574-132429596 CCCAGAACAGCACCCTTCCTGGG + Intergenic
1077273161 11:1691216-1691238 CCCAGGGCAGAGCCCTTGCCAGG - Intergenic
1078137297 11:8661989-8662011 CCCAGAACAGGACCCATTACTGG - Intronic
1082013465 11:47467017-47467039 CCCAGAGCAGAAACCCTGCTGGG + Intronic
1084171084 11:67401439-67401461 CACAGCGCAGGACCCCTTCCTGG + Intronic
1085415125 11:76314575-76314597 CCCAGAGCAGGGCCCAATCCAGG + Intergenic
1087922275 11:103879921-103879943 CCAAGGGGAGAACCCTTACCAGG - Intergenic
1089064800 11:115654306-115654328 CCCCGAGCTGAACCCTTTTGAGG - Intergenic
1089116992 11:116103382-116103404 CCCAGAGCAGCAGCTTGTCCCGG + Intergenic
1090333026 11:125945972-125945994 CCCAGAGCAGAGCCCAGCCCTGG - Intergenic
1090617692 11:128530746-128530768 CCCAAGAGAGAACCCTTTCCAGG + Intronic
1090892202 11:130933724-130933746 CCCAGAGTAGACTGCTTTCCAGG - Intergenic
1092066067 12:5590517-5590539 CCCAGACCAGAATCCATTTCGGG - Intronic
1092160841 12:6314724-6314746 CCTAGATCAGACCCCTCTCCAGG + Intronic
1093173093 12:15881357-15881379 CCCAGAGAAAAGCCCTCTCCTGG + Intronic
1093319504 12:17696041-17696063 CGCAGAGCACAACTCTTTTCTGG - Intergenic
1095406913 12:41876653-41876675 CCAAGTGCAGATACCTTTCCAGG - Intergenic
1096465859 12:51847633-51847655 CCCCGCGCAGACCCCTTCCCAGG + Intergenic
1097147759 12:56953487-56953509 CCCTGAGCAAATCCCTTTTCTGG + Intronic
1102059361 12:109921150-109921172 CCAAGAGCCAAATCCTTTCCTGG + Intronic
1103759031 12:123234288-123234310 CCAAGGGCAGATCCATTTCCTGG - Intronic
1103935812 12:124475943-124475965 GCCAAAGCAGCACCCCTTCCAGG + Intronic
1104500230 12:129278251-129278273 CCCAGGGCACAATCATTTCCTGG + Intronic
1105281342 13:18964487-18964509 CCCAGTGCAGAACCCCTCCTGGG - Intergenic
1105290556 13:19050502-19050524 CCCAGTGCAGAACCCCTCCTGGG - Intergenic
1106635267 13:31522385-31522407 CCCAAAATAGAAACCTTTCCAGG + Intergenic
1106770625 13:32957772-32957794 CCAAGATCACACCCCTTTCCAGG - Intergenic
1107081356 13:36378234-36378256 CCCAGAGAAGAGCTCTTTCTAGG - Intergenic
1112236452 13:97642196-97642218 CCCAGAGCAGAAAACTCTTCAGG - Intergenic
1112407746 13:99136108-99136130 CCCAGCACAGAGCCCATTCCTGG - Intergenic
1113114309 13:106858578-106858600 CTCTGAGCAGAAACCTTACCAGG + Intergenic
1113961989 13:114131409-114131431 CCCAGAGCAAGACCGTTTCCTGG - Intronic
1114210926 14:20614008-20614030 CTCAAAGCAGAACCTTTTCGAGG - Intergenic
1114598515 14:23934761-23934783 ACCAGAGCAGAATGCTTTCAGGG + Intergenic
1115485764 14:33909917-33909939 CCCAGAGCTGAGACTTTTCCAGG + Intergenic
1115960912 14:38835823-38835845 CCCAGAGCAGAACACCCCCCAGG - Intergenic
1116861724 14:50000941-50000963 TCCAGAGCAGAGCCCTGCCCAGG + Intronic
1117071423 14:52060341-52060363 CTCACAGCTGAACACTTTCCAGG - Exonic
1117608092 14:57452577-57452599 ACCAGAGCAGAAACCTCTGCAGG - Intergenic
1117773614 14:59159296-59159318 CCCAGTGCAGAAAGCTTTCTAGG + Intergenic
1118316577 14:64729607-64729629 TCCAGAGCAGTGCACTTTCCCGG - Intronic
1119862220 14:77944438-77944460 CCCAGAGAATAATCCATTCCAGG - Intergenic
1121983301 14:98474182-98474204 ACCACAGGAGAACCATTTCCAGG + Intergenic
1123422443 15:20143987-20144009 CCCAGACCCAGACCCTTTCCTGG - Intergenic
1123442562 15:20302355-20302377 CCCAGACCCAGACCCTTTCCTGG + Intergenic
1123531671 15:21150527-21150549 CCCAGACCCAGACCCTTTCCTGG - Intergenic
1125793524 15:42387640-42387662 CCCAAAGCAGCATCATTTCCTGG - Intronic
1128709497 15:69861083-69861105 CCCAGAGCAGAGGCTTCTCCGGG - Intergenic
1129944096 15:79524277-79524299 CCCAAAGGAGAACCCCTTCAGGG - Intergenic
1132884000 16:2174464-2174486 CCCGGAGCAGCACTGTTTCCTGG + Intronic
1132897522 16:2236121-2236143 CCCTGAGCAGAATCCCTTCAGGG - Exonic
1136718648 16:32303181-32303203 CCCAGACCCAGACCCTTTCCTGG - Intergenic
1136773263 16:32858778-32858800 CCCAGACCCAGACCCTTTCCTGG + Intergenic
1136837020 16:33509445-33509467 CCCAGACCCAGACCCTTTCCTGG - Intergenic
1136897352 16:34002741-34002763 CCCAGACCCAGACCCTTTCCTGG - Intergenic
1137433382 16:48436119-48436141 CCCAGAGCAGAGCTCCTTTCTGG + Intronic
1137617916 16:49857893-49857915 CCCAAGTCAGAACCCTTCCCGGG - Intronic
1138343536 16:56306422-56306444 CCCCTAGCAGAACCCTTTGCTGG + Intronic
1140040339 16:71403261-71403283 CCCAAGGCAGAAGCCTGTCCTGG - Intergenic
1140862402 16:79029427-79029449 CACACATCAGAACCCTTTACTGG - Intronic
1203007783 16_KI270728v1_random:214590-214612 CCCAGACCCAGACCCTTTCCTGG + Intergenic
1203075685 16_KI270728v1_random:1120888-1120910 CCCAGACCCAGACCCTTTCCTGG + Intergenic
1203147198 16_KI270728v1_random:1809724-1809746 CCCAGACCCAGACCCTTTCCTGG - Intergenic
1147936565 17:44014688-44014710 CCCAGACCAGAACCCCTCCCAGG + Intronic
1148457296 17:47817964-47817986 CCTAGAGCACACCCCTTCCCTGG + Intronic
1149620530 17:58041403-58041425 ACCAGGGCAGAACCCTCTCTCGG + Intergenic
1151668821 17:75560283-75560305 GTCAGAGCAGAACACTTTGCAGG + Intronic
1152314285 17:79571326-79571348 CCCTGAGCAGAGCCCTGACCTGG + Intergenic
1152532668 17:80929041-80929063 CTCCGGGCAGAACCCTTTCATGG - Intronic
1152535758 17:80949568-80949590 CCCAGAGCAGAATGTGTTCCCGG + Intronic
1152567770 17:81107820-81107842 CCCAGAGCCCAAACCTCTCCAGG - Intronic
1152728348 17:81958578-81958600 CCCAGGACAGGACCCTTTCCAGG + Intronic
1153766617 18:8380826-8380848 CCCAGCCCAGATCCCATTCCTGG + Intronic
1154445383 18:14431434-14431456 CGGAGACCAGCACCCTTTCCCGG - Intergenic
1155056977 18:22193657-22193679 CCCAGAGCAGAAGACTTTGATGG - Intronic
1155087735 18:22474291-22474313 CCCAGAGCTGACCCCTTCCTCGG + Intergenic
1155464731 18:26121561-26121583 CCCAGTTCAGAACCCTTGCTGGG - Intergenic
1156245616 18:35295050-35295072 CCAAGACCAAAACCATTTCCTGG - Intergenic
1160051735 18:75440046-75440068 CCTCCAGCAGAACACTTTCCTGG - Intergenic
1160390144 18:78523854-78523876 CAAAGAGCAGAACAGTTTCCAGG + Intergenic
1162658201 19:12148331-12148353 TCAAGAGCAGAAACCTTTCTTGG + Intronic
1162710642 19:12591396-12591418 CCCAGAGCAGGACTCTTTTTTGG - Intronic
1166039551 19:40193292-40193314 CCCAGTTGAGAACCATTTCCTGG + Intronic
1166572276 19:43804757-43804779 CCCCGAGCACAACCCTGCCCCGG - Intronic
1167342342 19:48923104-48923126 CCCAGAGCTGACCCCACTCCAGG + Exonic
1168008597 19:53512052-53512074 CTCAGAGCAGCACCCTCTGCTGG + Intergenic
1202692260 1_KI270712v1_random:100738-100760 CCCAGACCCAGACCCTTTCCTGG - Intergenic
925125788 2:1455008-1455030 TCCAGGGGAGATCCCTTTCCTGG + Intronic
925426850 2:3756544-3756566 CCCAGGGCTGAACACTTGCCAGG - Intronic
927997583 2:27496749-27496771 CTCAGAGCACCACCCTTTCCTGG - Intergenic
928167589 2:28981993-28982015 CCCAGAGCAGAGCCCCTCCAAGG - Intronic
929100518 2:38307535-38307557 CCCAGACCAGACCAATTTCCTGG - Intronic
929921303 2:46173569-46173591 CCCAGGACAGAGCCCCTTCCTGG - Intronic
930718928 2:54620180-54620202 CCAAGGGCAGAAGCCTGTCCGGG - Intronic
931915852 2:66955591-66955613 TCCAGCGCAGCACTCTTTCCAGG - Intergenic
932236420 2:70124379-70124401 CCCAGAGCCGGAACCGTTCCCGG - Intergenic
932553210 2:72794000-72794022 CCCAGGGGACACCCCTTTCCTGG - Intronic
932737385 2:74263940-74263962 ACCAGAGCAGAACAATTTCTAGG - Intronic
932824132 2:74924839-74924861 CCCAGAGAAGCACCCTTTGCTGG - Intergenic
933656378 2:84890539-84890561 CCAAGAACAGATTCCTTTCCTGG - Intronic
933814201 2:86052675-86052697 CCCAGTGGAGAAGTCTTTCCAGG - Intronic
933814356 2:86053684-86053706 CCCAGTGGAGAAGTCTTTCCAGG - Intronic
933954138 2:87353234-87353256 CCCAGACCCAGACCCTTTCCTGG + Intergenic
934238333 2:90249454-90249476 CCCAGACCCAGACCCTTTCCTGG + Intergenic
934274856 2:91567256-91567278 CCCAGACCCAGACCCTTTCCTGG - Intergenic
934460758 2:94212814-94212836 CCCAGACCCAGACCCTTTCCTGG + Intergenic
934950079 2:98570236-98570258 CACAGAGCAGAGCCCTTTGGTGG + Intronic
937001824 2:118474614-118474636 CCTAGAGCAGCCCCTTTTCCAGG - Intergenic
937338103 2:121074501-121074523 CCCAGAGCCTAACCCATGCCGGG + Intergenic
943624075 2:190180258-190180280 CCAAGCGCAGAACCCTTAGCTGG + Intronic
944758331 2:202787043-202787065 CCCAGGGAAGCTCCCTTTCCTGG + Intronic
944882195 2:204024726-204024748 CACATAGCAGCACCCTTTCTAGG - Intergenic
946161659 2:217839426-217839448 ACCAGAGCAGCCCCCTTCCCAGG + Intronic
946344521 2:219097987-219098009 TCCAGAGCAATACACTTTCCTGG - Intronic
946373992 2:219297287-219297309 CCCACAGCAGCACCCCGTCCTGG - Exonic
947107644 2:226684488-226684510 ACCAGGGCAGTACCCTTTTCTGG - Intergenic
948795709 2:240401152-240401174 CCCACAGCAGGACCATCTCCTGG + Intergenic
1169455179 20:5746371-5746393 CCCAAAACAAATCCCTTTCCTGG + Intergenic
1170432082 20:16284970-16284992 CCCAGAGCAGCACCATCTTCTGG + Intronic
1174651653 20:52130745-52130767 CTCAGATCAGAACACTCTCCAGG + Intronic
1174748501 20:53088087-53088109 CCCAGAGCAGAACTATGCCCAGG - Intronic
1176292629 21:5054273-5054295 CACAGAGCAGGACCCCTTCAGGG - Intergenic
1179020057 21:37631754-37631776 CTCACAGCAGCACCTTTTCCTGG - Intronic
1179864631 21:44209377-44209399 CACAGAGCAGGACCCCTTCAGGG + Intergenic
1180090096 21:45529429-45529451 CCCAGCTCAGTACCCCTTCCTGG - Intronic
1183365711 22:37405732-37405754 CCTGGATCTGAACCCTTTCCTGG + Intronic
1185045834 22:48528339-48528361 CCCAGAGCAGAACCCTTTCCTGG - Intronic
949545788 3:5071071-5071093 CCAAGGGCAGAAACCTTGCCCGG + Intergenic
950658331 3:14451140-14451162 CCCAGCTCAGAACCCTCTCATGG + Intronic
950709558 3:14804730-14804752 CCCAGAGCTCAGCCCTTTCTTGG + Intergenic
953844860 3:46419148-46419170 CCCAGGGCAGAACCCCTTGGGGG - Intergenic
954060673 3:48064087-48064109 CCCAGAACAAACCCCCTTCCTGG + Intronic
956673177 3:71710299-71710321 TCCAGAGCAGAACCCTGGACAGG + Intronic
961195680 3:124999436-124999458 TCCAGGGCAGAAACCTGTCCAGG + Intronic
961587838 3:127948677-127948699 CCCAGAGCTGGAGGCTTTCCCGG - Intronic
961672276 3:128541983-128542005 TCCAGAGCTCAACCCTTGCCAGG - Intergenic
962430405 3:135313526-135313548 ACCAGGTCAGAACCCTCTCCAGG + Intergenic
963575326 3:147053550-147053572 CCAAGAGGAGAACCCTTACAAGG + Intergenic
963662338 3:148142522-148142544 CCCAAAACAGATCCCTTTCCAGG - Intergenic
965401078 3:168213563-168213585 TCAAGAGCAAAACCTTTTCCAGG + Intergenic
965668699 3:171123629-171123651 CCCAGAGCACTACCATTCCCAGG + Exonic
966250027 3:177855208-177855230 CCAAGAGCAGAACACATTCTTGG - Intergenic
966847289 3:184140569-184140591 CCCAGAGCTGCACTCATTCCCGG + Exonic
966853343 3:184177672-184177694 CCCAGAGCAGCTCCATATCCTGG + Intronic
967839846 3:193996404-193996426 CTCAGAGAAGAACCATTTCCAGG + Intergenic
968596658 4:1489491-1489513 CCCAGGGCAAAAGCCTGTCCTGG - Intergenic
969699178 4:8756949-8756971 CACAGAGCAGTACCTTTTCATGG + Intergenic
972878973 4:43400014-43400036 CTCAGAGCAGGAGACTTTCCAGG - Intergenic
974186730 4:58456807-58456829 GCCAGAGCAGATGCCTTTCGAGG - Intergenic
976758204 4:88520868-88520890 CCCAAAACAGAATCATTTCCTGG - Intergenic
976997707 4:91456138-91456160 CCCACAGGAGAACCCTCTCCAGG - Intronic
977226996 4:94404105-94404127 CCCAGTGCATAACACTTTTCAGG + Intergenic
978480455 4:109184285-109184307 CCCAGAGCAGAATCCTCTAGAGG - Intronic
979082435 4:116360580-116360602 CCCAGTGCAGAAACCTTTGGTGG + Intergenic
980795044 4:137671696-137671718 CCCAGAGCAAAAGCCTATTCTGG + Intergenic
983046243 4:162989909-162989931 CCCTGTGCGGGACCCTTTCCTGG - Intergenic
983880186 4:172923975-172923997 GACAGAGCAGAACCATTTCAGGG + Intronic
986728138 5:10615034-10615056 TCCAGAGCAGAACCCTTCACTGG + Intronic
987061895 5:14251106-14251128 CCAAGAGCAGAAAGCTGTCCTGG - Intronic
987117624 5:14738302-14738324 CTCAGAACAGCCCCCTTTCCAGG - Intronic
990085798 5:51975088-51975110 CCCAGGGCAGATCGCTTTCAAGG - Intergenic
991041993 5:62185775-62185797 ACCAGAGCAGAATCCTAGCCGGG + Intergenic
994260911 5:97657543-97657565 CACAGAGCTGAGACCTTTCCTGG + Intergenic
996029187 5:118685735-118685757 TGCACAGCAGAACCCTTTCAGGG + Intergenic
996103714 5:119473335-119473357 AACAGAGCAAGACCCTTTCCAGG - Intronic
996217114 5:120882539-120882561 CCCAGAGCAGGCTGCTTTCCTGG - Intergenic
996343918 5:122469518-122469540 CCAAGAGCACAACCTTTCCCTGG + Intergenic
997010795 5:129875065-129875087 CCCAGAGCAGAATGCTTTTCGGG + Intergenic
997296444 5:132771787-132771809 ACCAGAGCCGAAGCCTTTCCTGG - Intronic
997980999 5:138467253-138467275 CCCAGACCAGAAGCCCTTCCAGG + Exonic
998524626 5:142831280-142831302 CCCAGAGAAGAACTGTTTCCAGG - Intronic
999239011 5:150116872-150116894 CGCAGAGGAGAAGCCTTCCCAGG + Intronic
1002303825 5:178272185-178272207 CCCAGAGCAGGAGGCTGTCCCGG - Intronic
1002441446 5:179266492-179266514 CCCAGGGCAGAATCCATTCCTGG - Intronic
1003395485 6:5749163-5749185 CCCAGACCTGGACCCTTCCCTGG - Intronic
1003485237 6:6569984-6570006 GGCAGAGCCGAACCCTTTCTAGG - Intergenic
1003634977 6:7823889-7823911 CTCAGAGCAAAAACCTTTTCAGG - Intronic
1007116198 6:39345042-39345064 CTCAGAGCAGTACACTTGCCTGG + Intronic
1011293322 6:85800309-85800331 CTCAGAACACAACCCCTTCCAGG - Intergenic
1013589750 6:111610117-111610139 CCCAGAGCAGTCTCCCTTCCAGG + Intergenic
1014163642 6:118199072-118199094 CTCAGAGCAGAATACTTTCAGGG - Intronic
1015212102 6:130710125-130710147 CCCAGAGCACAACATTCTCCTGG + Intergenic
1015836024 6:137421059-137421081 GCCAGATCAAAACCCTGTCCTGG + Intergenic
1016220438 6:141663272-141663294 GACAGAGGAGAACACTTTCCAGG + Intergenic
1018161072 6:161042757-161042779 CCCAAGCCAAAACCCTTTCCAGG + Intronic
1018699039 6:166412590-166412612 CCCAGGTCAGGACCCTCTCCGGG + Exonic
1019779109 7:2929358-2929380 CCCAGCCCAGAACCCCTACCCGG - Intronic
1019921817 7:4168060-4168082 CCCAGTTCAGAACCCTGTGCAGG + Intronic
1019974916 7:4573491-4573513 CACAGAGCAGAGCCCATCCCAGG + Intergenic
1021969055 7:25950269-25950291 CTCAGATTAGAACCCATTCCTGG + Intergenic
1022222704 7:28329688-28329710 CAGAGAGCTGAACCCTTTCATGG - Intronic
1022548209 7:31209009-31209031 CCCACAGCACAGCTCTTTCCAGG - Intergenic
1024954094 7:54897861-54897883 CCCAGACCAAAACCCTTTCATGG - Intergenic
1027140446 7:75653201-75653223 CCCAGAGCAGACCCCCAGCCTGG - Intronic
1028951810 7:96644658-96644680 CCCAGGGCAGAATGCTTTCAGGG + Intronic
1029188918 7:98758468-98758490 CGCAGAGCAAAGTCCTTTCCAGG - Intergenic
1034413699 7:150954334-150954356 CACAGAGAAGAGCCCTGTCCAGG - Intronic
1034590418 7:152133606-152133628 TGTGGAGCAGAACCCTTTCCTGG - Intergenic
1037807941 8:22068907-22068929 CCCAAAGCCGCACACTTTCCTGG - Intronic
1039896550 8:41720553-41720575 CCCAGAGCTTAACCCATACCAGG - Intronic
1041143330 8:54845243-54845265 CCCAGAGCTGCACCCTTTCTAGG - Intergenic
1042737828 8:72008688-72008710 CTTAGAGCAGAAGCATTTCCTGG - Intronic
1044484618 8:92736921-92736943 CCCTGGGCAGAACTGTTTCCTGG + Intergenic
1044683557 8:94805596-94805618 CCCAGGGCAGACTGCTTTCCAGG - Intergenic
1047051411 8:121117289-121117311 CCCAGAGCAGAATGGTTTCAGGG + Intergenic
1047538582 8:125742561-125742583 CCCACAGCCAAACCCTGTCCTGG + Intergenic
1049844436 8:144793104-144793126 CCCTGACCAGAACCCTGTGCGGG + Intergenic
1050100954 9:2119259-2119281 CCCAGAGCAAAATCCGTTCAGGG - Intronic
1052157754 9:25215649-25215671 CCCAGAGCAGGAAACTTGCCAGG - Intergenic
1052297760 9:26917096-26917118 CCCACAGCAGATCCTTTTACAGG - Exonic
1053026203 9:34730383-34730405 ACCAGAGCAGAACTCTCTCAAGG - Intergenic
1053691256 9:40588512-40588534 CCCAGACCCAGACCCTTTCCTGG + Intergenic
1054273545 9:63048973-63048995 CCCAGACCCAGACCCTTTCCTGG - Intergenic
1054302516 9:63389483-63389505 CCCAGACCCAGACCCTTTCCTGG + Intergenic
1054401289 9:64715983-64716005 CCCAGACCCAGACCCTTTCCTGG + Intergenic
1054434897 9:65200303-65200325 CCCAGACCCAGACCCTTTCCTGG + Intergenic
1054495492 9:65821378-65821400 CCCAGACCCAGACCCTTTCCTGG - Intergenic
1054755177 9:68950433-68950455 CACAGGGCAGCACCCTTCCCAGG + Intronic
1056628940 9:88276777-88276799 CCCAAGCCAGGACCCTTTCCTGG + Intergenic
1060719004 9:125961696-125961718 CCCAGAGAAGAGACTTTTCCAGG - Intronic
1061155774 9:128860426-128860448 GCCAGAGCAGAAACCTTCCCTGG - Intronic
1061395844 9:130342935-130342957 CCCAGCGCCGAACCCTGCCCTGG + Intronic
1062147282 9:134996691-134996713 ACCAGAGCTCAACCCTGTCCTGG + Intergenic
1062460740 9:136661647-136661669 CCCAGAGCAGACCCTTCCCCTGG + Intronic
1062530359 9:136996906-136996928 CCCAGAGCCGCCCCCTTCCCAGG - Intergenic
1203738860 Un_GL000216v2:161724-161746 CCCAGGGGAGGACACTTTCCGGG + Intergenic
1187208517 X:17206185-17206207 ACCAGAGCAGCCCCCATTCCTGG + Intergenic
1187972042 X:24668552-24668574 CCCACAGGAGTACCTTTTCCAGG + Intronic
1188224911 X:27585549-27585571 ACAAGTGCTGAACCCTTTCCTGG + Intergenic
1190107912 X:47572502-47572524 CCCATTGCAGAATCCCTTCCTGG - Exonic
1193067697 X:77276587-77276609 CCCAATGCAGAACCCTTTCCTGG - Intergenic