ID: 1185045838

View in Genome Browser
Species Human (GRCh38)
Location 22:48528365-48528387
Sequence TATACACAGGCATCGGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 138}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185045838_1185045850 12 Left 1185045838 22:48528365-48528387 CCATTCCCCGATGCCTGTGTATA 0: 1
1: 0
2: 0
3: 4
4: 138
Right 1185045850 22:48528400-48528422 GTGAGGAGGCACCCCTGGAAGGG 0: 1
1: 0
2: 0
3: 23
4: 238
1185045838_1185045844 -5 Left 1185045838 22:48528365-48528387 CCATTCCCCGATGCCTGTGTATA 0: 1
1: 0
2: 0
3: 4
4: 138
Right 1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG 0: 1
1: 0
2: 0
3: 6
4: 89
1185045838_1185045848 7 Left 1185045838 22:48528365-48528387 CCATTCCCCGATGCCTGTGTATA 0: 1
1: 0
2: 0
3: 4
4: 138
Right 1185045848 22:48528395-48528417 CCATAGTGAGGAGGCACCCCTGG No data
1185045838_1185045845 -2 Left 1185045838 22:48528365-48528387 CCATTCCCCGATGCCTGTGTATA 0: 1
1: 0
2: 0
3: 4
4: 138
Right 1185045845 22:48528386-48528408 TAGCCAAGGCCATAGTGAGGAGG 0: 1
1: 0
2: 1
3: 10
4: 300
1185045838_1185045849 11 Left 1185045838 22:48528365-48528387 CCATTCCCCGATGCCTGTGTATA 0: 1
1: 0
2: 0
3: 4
4: 138
Right 1185045849 22:48528399-48528421 AGTGAGGAGGCACCCCTGGAAGG 0: 1
1: 0
2: 4
3: 32
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185045838 Original CRISPR TATACACAGGCATCGGGGAA TGG (reversed) Intronic
900084481 1:884228-884250 CAAACACAAGCAACGGGGAAAGG - Intergenic
900963312 1:5939725-5939747 TAGTCACTGGCATGGGGGAATGG - Intronic
901949600 1:12731871-12731893 CAAACACAAGCAACGGGGAAAGG - Intergenic
905938892 1:41847014-41847036 TATATAAAGGCATCCAGGAAAGG + Intronic
909047711 1:70730022-70730044 TATACACTGGCAAAGGGAAAAGG + Intergenic
915697485 1:157758814-157758836 TAAACACAAGCAATGGGGAAAGG + Intronic
920303016 1:205001023-205001045 TACACACAGTCATCTAGGAAAGG - Intronic
923458371 1:234186061-234186083 TAGAAACAGGCACCAGGGAAGGG + Intronic
924807983 1:247376846-247376868 TAAACACAGGCATGGATGAAAGG - Intergenic
1063274888 10:4554971-4554993 TATACACACACATTGTGGAATGG - Intergenic
1063658445 10:8014842-8014864 TATCCACAGGCATCTGGGGGTGG - Exonic
1063853151 10:10216158-10216180 TATATATTGACATCGGGGAAAGG - Intergenic
1064191165 10:13207239-13207261 AATACACAGGCAACTGGGCACGG + Intronic
1067296981 10:44980203-44980225 TGCACAAAGGCATCGGGGCAGGG + Intronic
1073038355 10:100580162-100580184 TCTACACTGGCACGGGGGAAAGG - Intergenic
1074076286 10:110128922-110128944 TATACACAGAGCTCGGGGATTGG + Intronic
1077164277 11:1128218-1128240 TACACACAGGCTTCAAGGAAAGG - Intergenic
1077821536 11:5747498-5747520 TATACACATACATTGTGGAAAGG - Intronic
1078606744 11:12783927-12783949 TATACACAGGAAGGGGGGATGGG + Intronic
1086845846 11:91748663-91748685 TATACCCAGTCTTCAGGGAAAGG + Intergenic
1089467224 11:118693073-118693095 TATATACAGGCAACGAGGAATGG - Intergenic
1090970961 11:131642607-131642629 TCTGGACAGGCATCAGGGAATGG - Intronic
1096650493 12:53059876-53059898 TGTAGTCAGGCATCGGGGCATGG - Exonic
1098035860 12:66301873-66301895 TATAGACAGGAATAGGAGAAGGG - Intergenic
1098219632 12:68255245-68255267 TATACGCATGCATTGTGGAATGG - Intergenic
1098602473 12:72348137-72348159 TATACACACACATTGTGGAATGG + Intronic
1101430205 12:104620385-104620407 TATTCACGGTCATGGGGGAAAGG + Intronic
1102696873 12:114806891-114806913 TATACACAGGCAGAGGAAAATGG - Intergenic
1103162313 12:118739728-118739750 TATAGAAAGGAATGGGGGAAGGG + Intergenic
1103924890 12:124418236-124418258 TATCCGCAGGGATCGTGGAAGGG - Intronic
1112682302 13:101780774-101780796 GATACACAGGCTATGGGGAAGGG + Intronic
1113766166 13:112882278-112882300 AAGACACAGGCCTGGGGGAATGG - Exonic
1115289537 14:31754027-31754049 TATATGCAGACATCGTGGAATGG - Intronic
1116690432 14:48099407-48099429 CAAACACAAGCAACGGGGAAAGG - Intergenic
1117070280 14:52049870-52049892 TCTTCACAGGCATCGGGGGGCGG + Intronic
1118812023 14:69282201-69282223 TCCACACAGGCAGCGGGCAAGGG - Intronic
1119425854 14:74534279-74534301 TACCCACAGGCTTTGGGGAAAGG - Intronic
1121905443 14:97737812-97737834 CATAAACAGGCAATGGGGAAAGG - Intergenic
1129030363 15:72612973-72612995 TAGACACAGGAAAAGGGGAAGGG + Intergenic
1133627162 16:7581585-7581607 TATTCACAGGAATCAGAGAAGGG + Intronic
1137767052 16:50985735-50985757 TATATATATGCATCTGGGAAAGG - Intergenic
1140151234 16:72368939-72368961 TATACACAGGCATCATGAAAAGG + Intergenic
1140243008 16:73220643-73220665 TATACAAAGGCATCTGGTGAAGG + Intergenic
1141278141 16:82606504-82606526 AAAACACAGGCAGCAGGGAAGGG - Intergenic
1149204807 17:54231374-54231396 TAAATACTGGCATTGGGGAAAGG - Intergenic
1152297337 17:79475726-79475748 GATACACAGGCATGGGGGTGGGG + Intronic
1152637404 17:81435758-81435780 GACACACAGGCATCCTGGAAGGG - Intronic
1152637427 17:81435830-81435852 GACACACAGGCATCCTGGAAGGG - Intronic
1153134373 18:1897067-1897089 TATAATCAGGCAACGGGGCAGGG + Intergenic
1153349747 18:4066048-4066070 TAAAAACAGGCAATGGGGAAAGG + Intronic
1159050333 18:63415788-63415810 TATAGAAATTCATCGGGGAAGGG - Intronic
1162434026 19:10645964-10645986 GAAACAAAGGCATCGAGGAAGGG - Intergenic
1163333779 19:16658738-16658760 CATTCACAGGCATCGGAGGACGG + Intronic
1165707462 19:37986727-37986749 TTTACACAGGAAGAGGGGAAAGG - Intronic
927926268 2:27015962-27015984 CATTCACAGGCAACTGGGAAAGG - Intronic
931038068 2:58265423-58265445 TACACTCAGGGATCAGGGAATGG + Intergenic
932223446 2:70019970-70019992 TATACACACACATTGTGGAATGG - Intergenic
933006465 2:77001754-77001776 TATACAAGGGCATGGGAGAAAGG - Intronic
936417270 2:112327770-112327792 TAAAAACATACATCGGGGAAAGG - Intronic
941127171 2:161598251-161598273 TAAACACATGCAATGGGGAAAGG + Intronic
941129280 2:161626113-161626135 TATACACAGGAATCGTGGTATGG + Intronic
941251056 2:163163291-163163313 AATACATAGTCATAGGGGAATGG + Intergenic
943250594 2:185517245-185517267 TAAAAACAAGCAACGGGGAAAGG - Intergenic
944108187 2:196102096-196102118 CATTCACAGGCAAAGGGGAATGG - Intergenic
944126708 2:196302147-196302169 CAAAAACAGGCATTGGGGAAAGG - Intronic
944378414 2:199076472-199076494 TAAAAACAAGCAACGGGGAAAGG + Intergenic
945125392 2:206503987-206504009 TTTATACAGGCTTCTGGGAATGG + Intronic
1171318069 20:24213096-24213118 TCTTCACAGGCATAGGGCAAAGG - Intergenic
1174921006 20:54702054-54702076 TATACACATTCATTGGGAAAGGG - Intergenic
1175227170 20:57451338-57451360 GATACACAGCCCTCTGGGAAAGG - Intergenic
1175443508 20:59006264-59006286 TATAAACAGGCAGCCGGGATGGG + Intronic
1176937531 21:14884113-14884135 TATATACAGGTATCTGGAAATGG - Intergenic
1177730397 21:25021623-25021645 TATGCACAAGCATCAGGGTATGG - Intergenic
1178453985 21:32729636-32729658 GACACACAGGCATGGTGGAAAGG - Intergenic
1179006383 21:37519005-37519027 TATAAACAAGCCTCCGGGAAAGG + Intergenic
1181916023 22:26280827-26280849 AATATGCAGGCATCGTGGAATGG + Intronic
1185045838 22:48528365-48528387 TATACACAGGCATCGGGGAATGG - Intronic
950165298 3:10792797-10792819 TCTACACACCCAACGGGGAAGGG + Intergenic
950483701 3:13260601-13260623 TAGACTCAGGCATCGGTGAGGGG - Intergenic
953733725 3:45472934-45472956 GATCCCCAGGCATCTGGGAAGGG - Intronic
954006842 3:47597953-47597975 AATACAGAGGTATCGGTGAAGGG + Intronic
954362152 3:50127572-50127594 GGTAAACAGGCATCGGGGGAAGG + Intergenic
957434868 3:80161652-80161674 AATGCACAGGCATAGTGGAAAGG + Intergenic
960672309 3:120165546-120165568 TATACACAGGACTCGGGGCAGGG + Exonic
963835649 3:150055644-150055666 TACACACAGGCGTGGGGGATAGG + Intergenic
967233818 3:187366090-187366112 TAGACACAGGTATCCAGGAAGGG + Intergenic
971722013 4:30256525-30256547 TTTGCACAGGGATTGGGGAATGG + Intergenic
974476134 4:62382995-62383017 TATCTACAAGCATGGGGGAAGGG - Intergenic
976943329 4:90733784-90733806 CCTAGACATGCATCGGGGAAAGG - Intronic
981453655 4:144928859-144928881 TAAACACAAGCAATGGGGAAAGG - Intergenic
981775582 4:148363421-148363443 AAGTCACAGGCATCGGGGACAGG + Intronic
986553208 5:8981720-8981742 TATAAACAAGCTTGGGGGAAAGG + Intergenic
986945463 5:13013169-13013191 TAAAAACAGGCAATGGGGAAAGG - Intergenic
996233276 5:121092741-121092763 TACACATAGGCACCAGGGAAAGG - Intergenic
998932600 5:147198020-147198042 TAAAAACAAGCAACGGGGAAAGG + Intergenic
999738888 5:154534273-154534295 TTTACACAGGCAAGAGGGAATGG + Intergenic
1000390972 5:160722969-160722991 TAAACACAGCCATCAGTGAAAGG - Intronic
1002782315 6:376732-376754 TATACACACACATTGTGGAAAGG - Intergenic
1004729710 6:18345769-18345791 AAGACACAGGCATCTGGGGATGG + Intergenic
1005209451 6:23443551-23443573 TATACACAGGCAAGAGGGCATGG + Intergenic
1007209432 6:40180327-40180349 TAAACTCAGGCCTTGGGGAAAGG + Intergenic
1008733709 6:54515741-54515763 TATTCTCAGACATCAGGGAAGGG + Intergenic
1010345444 6:74804827-74804849 TAAAAACAAGCAACGGGGAAAGG - Intergenic
1013310961 6:108893450-108893472 TATCTGCAGGGATCGGGGAAGGG + Intronic
1014200251 6:118601465-118601487 TATACATAAGCATGGGGAAAAGG - Intronic
1018263012 6:161989485-161989507 TATGCACAGGCATCAAGGACAGG - Intronic
1019750455 7:2725878-2725900 TATACAGAGGCACCAGGGGAGGG - Intronic
1020837505 7:13172041-13172063 TAAACACAGGCAGCTGGGATGGG - Intergenic
1022994470 7:35740459-35740481 TAAAAACAAGAATCGGGGAAAGG - Intergenic
1025026630 7:55521767-55521789 TGCACACAGGCATCGGAGCAGGG + Intronic
1026150721 7:67786038-67786060 TATACGCAGGAGTGGGGGAAGGG + Intergenic
1028019798 7:85755993-85756015 TAAAAACAAGCAACGGGGAAAGG + Intergenic
1028541022 7:91941958-91941980 TATACACAGGCATCGTTCATTGG + Intronic
1029657552 7:101936973-101936995 GAGACACAGTCACCGGGGAAGGG + Intronic
1030525175 7:110644232-110644254 TAAACACAGCCATAAGGGAAGGG - Intergenic
1032869661 7:135970316-135970338 TGTTCACAGGCATTGGGGAGGGG + Intronic
1032963527 7:137068928-137068950 TATACATAGGCTTTGGGGTAGGG - Intergenic
1037731794 8:21532038-21532060 TATACAGAGGCCTAGGAGAATGG - Intergenic
1038375821 8:27039214-27039236 AACACACAGGCATGGGGGACTGG - Intergenic
1039099527 8:33926078-33926100 TATACACAGGCACTGCTGAATGG - Intergenic
1041409103 8:57533915-57533937 TATACACAGGCAGCTGGCACGGG + Intergenic
1044222773 8:89688791-89688813 AATACACAAACATGGGGGAATGG + Intergenic
1047853603 8:128885608-128885630 TAGACAGAGGCAGCAGGGAAAGG - Intergenic
1048704588 8:137138438-137138460 TATACAAACACATCGGTGAAAGG - Intergenic
1051244787 9:15098947-15098969 TATACATGGGCATTGTGGAAGGG - Intergenic
1051862924 9:21647062-21647084 TAAAAACAAGCAACGGGGAAAGG - Intergenic
1052550219 9:29938379-29938401 TAAACAGAGGCATTGGGAAAAGG - Intergenic
1053147051 9:35718947-35718969 TATGCACAGGCATGTGGGCAGGG - Intronic
1054750240 9:68898081-68898103 TATACACAGGGGTCTGGGACTGG - Intronic
1055470047 9:76602091-76602113 TATGGACAAGCTTCGGGGAAAGG - Intergenic
1055630500 9:78218845-78218867 TGTGGACAGGCATTGGGGAAGGG + Intergenic
1056657173 9:88519197-88519219 TAGACACAGCCATCAGGAAAGGG + Intergenic
1057730391 9:97603212-97603234 GAGACACAGGCCTCGGGGAGAGG - Intronic
1058255334 9:102754890-102754912 TATACACACACATTGTGGAATGG - Intergenic
1186457089 X:9718223-9718245 AAAACCCAGCCATCGGGGAAGGG + Exonic
1190708788 X:53050563-53050585 TACACACACCCATCAGGGAAGGG - Intronic
1191978277 X:66897450-66897472 TATACACGGGCATGTGGGGAAGG + Intergenic
1193044901 X:77042422-77042444 TATAAACAAGCAATGGGGAAAGG + Intergenic
1194803999 X:98305080-98305102 CAAAAACAAGCATCGGGGAAAGG + Intergenic
1196022796 X:111007710-111007732 AACACACAGGCAGAGGGGAAAGG - Intronic
1196859339 X:120012926-120012948 AATATTCAGGCATTGGGGAAAGG - Intergenic
1197497256 X:127200185-127200207 TTGACACAGGCAATGGGGAAAGG - Intergenic
1199276177 X:145945064-145945086 TGAACACAGGCACCAGGGAAAGG - Intergenic