ID: 1185045839

View in Genome Browser
Species Human (GRCh38)
Location 22:48528370-48528392
Sequence TTGGCTATACACAGGCATCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 56}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185045839_1185045845 -7 Left 1185045839 22:48528370-48528392 CCCCGATGCCTGTGTATAGCCAA 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1185045845 22:48528386-48528408 TAGCCAAGGCCATAGTGAGGAGG 0: 1
1: 0
2: 1
3: 10
4: 300
1185045839_1185045849 6 Left 1185045839 22:48528370-48528392 CCCCGATGCCTGTGTATAGCCAA 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1185045849 22:48528399-48528421 AGTGAGGAGGCACCCCTGGAAGG 0: 1
1: 0
2: 4
3: 32
4: 254
1185045839_1185045844 -10 Left 1185045839 22:48528370-48528392 CCCCGATGCCTGTGTATAGCCAA 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG 0: 1
1: 0
2: 0
3: 6
4: 89
1185045839_1185045848 2 Left 1185045839 22:48528370-48528392 CCCCGATGCCTGTGTATAGCCAA 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1185045848 22:48528395-48528417 CCATAGTGAGGAGGCACCCCTGG No data
1185045839_1185045850 7 Left 1185045839 22:48528370-48528392 CCCCGATGCCTGTGTATAGCCAA 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1185045850 22:48528400-48528422 GTGAGGAGGCACCCCTGGAAGGG 0: 1
1: 0
2: 0
3: 23
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185045839 Original CRISPR TTGGCTATACACAGGCATCG GGG (reversed) Intronic
900003939 1:31789-31811 GTGTATATTCACAGGCATCGTGG - Intergenic
900023663 1:202308-202330 GTGTATATTCACAGGCATCGTGG - Intergenic
904617865 1:31759746-31759768 CTGGCTATACACAGGCAGGAGGG - Intronic
905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG + Intronic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
907509499 1:54947666-54947688 TCGGCTAGAAACAGGCATTGTGG - Intergenic
912075835 1:105873879-105873901 TTGGCTATACACTGTCACAGGGG + Intergenic
919891013 1:201974618-201974640 TTGGCTATAAAAAGGCAGCATGG - Intergenic
1067576439 10:47411712-47411734 TTGGCAACACTCAGGCATCCGGG + Intergenic
1074353641 10:112762139-112762161 GTGGCCAAACACTGGCATCGCGG + Intronic
1091377360 12:33840-33862 GTGTATATTCACAGGCATCGTGG - Intergenic
1091435916 12:472868-472890 TTGGCTAGACACAGTCACAGTGG - Intronic
1092972196 12:13706970-13706992 TTGGCTATAGAGAGGCAATGAGG + Intronic
1097388928 12:58985050-58985072 TTGTCTATAGCCAGGCATAGTGG - Intergenic
1103586439 12:121959710-121959732 TTGGCTTTCCACAGACAGCGAGG + Intronic
1117348731 14:54860020-54860042 TTGGGTATACACAGGGGTCCTGG - Intronic
1132449565 15:101959153-101959175 GTGTATATTCACAGGCATCGTGG + Intergenic
1134130072 16:11643151-11643173 TTGGCTATTCCAAGGCATCAGGG - Intergenic
1134557571 16:15178898-15178920 TTGGCTCTTCACTGGCATCTGGG - Intergenic
1134662279 16:15993163-15993185 TGGGCTAGTCACAGGCATGGGGG - Intronic
1134918138 16:18090581-18090603 TTGGCTCTTCACTGGCATCTGGG - Intergenic
1143034916 17:3989275-3989297 CTGGCTCTCCACAGGCATTGGGG + Intergenic
1154958300 18:21281741-21281763 TTGGCTGTAAACAGGCATGAGGG + Intronic
1160099326 18:75905337-75905359 TTGAGGATACACAGGCATGGAGG + Intergenic
1160635691 19:73398-73420 GTGTATATTCACAGGCATCGTGG - Intergenic
1164612244 19:29640411-29640433 TGGGCTGTCCACAGGCACCGTGG + Intergenic
1165369669 19:35396899-35396921 TTGGCTAAACGCAGGCATCAGGG - Intergenic
932368075 2:71165933-71165955 TTGCATTTACACAGGCATCCGGG - Intergenic
936565787 2:113581652-113581674 GTGTATATTCACAGGCATCGTGG + Intergenic
937888286 2:126915414-126915436 TTGGGTATACAGAGGCACCAGGG - Intergenic
948470669 2:238175833-238175855 GTGGCTATTCACAGACATGGTGG + Intronic
1174591410 20:51648161-51648183 CAGGCTATACCCAGGCATGGAGG + Intronic
1179500168 21:41803656-41803678 TTGGCAAGTCACAGGCATGGGGG - Intronic
1180080638 21:45486180-45486202 TAGGGTAGACACAGGCATTGCGG - Intronic
1185045839 22:48528370-48528392 TTGGCTATACACAGGCATCGGGG - Intronic
949639359 3:6017685-6017707 TTGGCTATACATAGGAAAAGAGG + Intergenic
951387283 3:22058055-22058077 TTGGCTATACACACCCTTCTAGG + Intronic
962606402 3:137035996-137036018 TGGGCTATTCTCAGGCATGGGGG + Intergenic
971968844 4:33595655-33595677 GTGGCAAGACACAGGCATGGTGG - Intergenic
974084393 4:57244042-57244064 CTGTCTATACACAGACATAGTGG + Intergenic
979710410 4:123772660-123772682 CTGGCTGTACACACGCATGGGGG + Intergenic
986854920 5:11857327-11857349 GTGGCGATACAAAGGCACCGAGG + Intronic
992891878 5:81211220-81211242 TTGGGAATACACAGGCAGCATGG - Intronic
998545720 5:143025785-143025807 TTGGCAAAAGACAGGCATCCAGG - Intronic
1000842035 5:166231968-166231990 TTGGTTAAACACAGGCATAGAGG - Intergenic
1003439717 6:6128304-6128326 TAGACTATACACAGGCATTTTGG - Intergenic
1007843504 6:44735700-44735722 TTGGGAAAACACAGGCATGGAGG + Intergenic
1021181079 7:17506793-17506815 TTGGCTAAAGGCAGGCATCTGGG + Intergenic
1021764958 7:23939625-23939647 GTGGCTATAGCCAGGCATGGTGG + Intergenic
1023685511 7:42730478-42730500 TTGGCAATACACAGGCAGCAAGG - Intergenic
1032305405 7:130729408-130729430 TTTGGTATACACAGGGATCCTGG - Intergenic
1037275513 8:17173954-17173976 TTGGATACAGAGAGGCATCGAGG + Intronic
1042277215 8:67018473-67018495 GTGGCTATTCACAGGCATGTAGG + Intronic
1047980990 8:130181948-130181970 TTACCTATACACAGACATAGTGG + Intronic
1048053109 8:130837892-130837914 TTGGCTATAAAGTGGCATCTAGG + Intronic
1049651988 8:143773991-143774013 TTGGCCATCCACAGGCAAAGGGG + Intergenic
1049886633 9:31571-31593 GTGTATATTCACAGGCATCGTGG - Intergenic
1056567278 9:87785284-87785306 TTGACTTTACACAGACATCTCGG + Intergenic
1187207192 X:17194023-17194045 TTGGGTTATCACAGGCATCGGGG - Intergenic
1196206503 X:112946142-112946164 TGGACTATAGAGAGGCATCGAGG + Intergenic
1198217672 X:134570624-134570646 TTGGCTATACAAATGCATCTAGG - Intronic