ID: 1185045839

View in Genome Browser
Species Human (GRCh38)
Location 22:48528370-48528392
Sequence TTGGCTATACACAGGCATCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185045839_1185045848 2 Left 1185045839 22:48528370-48528392 CCCCGATGCCTGTGTATAGCCAA No data
Right 1185045848 22:48528395-48528417 CCATAGTGAGGAGGCACCCCTGG No data
1185045839_1185045845 -7 Left 1185045839 22:48528370-48528392 CCCCGATGCCTGTGTATAGCCAA No data
Right 1185045845 22:48528386-48528408 TAGCCAAGGCCATAGTGAGGAGG No data
1185045839_1185045849 6 Left 1185045839 22:48528370-48528392 CCCCGATGCCTGTGTATAGCCAA No data
Right 1185045849 22:48528399-48528421 AGTGAGGAGGCACCCCTGGAAGG No data
1185045839_1185045844 -10 Left 1185045839 22:48528370-48528392 CCCCGATGCCTGTGTATAGCCAA No data
Right 1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG No data
1185045839_1185045850 7 Left 1185045839 22:48528370-48528392 CCCCGATGCCTGTGTATAGCCAA No data
Right 1185045850 22:48528400-48528422 GTGAGGAGGCACCCCTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185045839 Original CRISPR TTGGCTATACACAGGCATCG GGG (reversed) Intronic