ID: 1185045844

View in Genome Browser
Species Human (GRCh38)
Location 22:48528383-48528405
Sequence GTATAGCCAAGGCCATAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185045834_1185045844 21 Left 1185045834 22:48528339-48528361 CCAGGAAAGGGTTCTGCTCTGGG No data
Right 1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG No data
1185045839_1185045844 -10 Left 1185045839 22:48528370-48528392 CCCCGATGCCTGTGTATAGCCAA No data
Right 1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG No data
1185045838_1185045844 -5 Left 1185045838 22:48528365-48528387 CCATTCCCCGATGCCTGTGTATA No data
Right 1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185045844 Original CRISPR GTATAGCCAAGGCCATAGTG AGG Intronic