ID: 1185045844

View in Genome Browser
Species Human (GRCh38)
Location 22:48528383-48528405
Sequence GTATAGCCAAGGCCATAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185045834_1185045844 21 Left 1185045834 22:48528339-48528361 CCAGGAAAGGGTTCTGCTCTGGG 0: 1
1: 0
2: 1
3: 21
4: 232
Right 1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG 0: 1
1: 0
2: 0
3: 6
4: 89
1185045838_1185045844 -5 Left 1185045838 22:48528365-48528387 CCATTCCCCGATGCCTGTGTATA 0: 1
1: 0
2: 0
3: 4
4: 138
Right 1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG 0: 1
1: 0
2: 0
3: 6
4: 89
1185045839_1185045844 -10 Left 1185045839 22:48528370-48528392 CCCCGATGCCTGTGTATAGCCAA 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG 0: 1
1: 0
2: 0
3: 6
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185045844 Original CRISPR GTATAGCCAAGGCCATAGTG AGG Intronic
906793618 1:48679438-48679460 GTACAACCAGGGCCACAGTGGGG + Intronic
908545942 1:65162207-65162229 GTATCGCCCAGGCTAGAGTGCGG - Intronic
910208646 1:84772709-84772731 TTATGGCAAAGGCCTTAGTGCGG + Intergenic
912804106 1:112742388-112742410 CCAGAGCCTAGGCCATAGTGGGG + Intergenic
914735460 1:150412084-150412106 CTATCGCCCAGGCCAGAGTGCGG - Intronic
920232939 1:204482268-204482290 GAATAGCCAAGGCCAGGGTTTGG - Intronic
1064994674 10:21286079-21286101 AAAGAGCCAAGGTCATAGTGAGG - Intergenic
1066565665 10:36719390-36719412 GTATAGCTAAGGCAATCTTGGGG + Intergenic
1066961386 10:42230783-42230805 GTAGGGCCAAGGCCAAGGTGGGG + Intergenic
1067796402 10:49325222-49325244 GAATTGCCAAGGCCAGAATGGGG + Exonic
1069374565 10:67781022-67781044 GTATAACCAACGCCATAGCATGG + Intergenic
1076746405 10:132517024-132517046 GTCTGGCCAGGGCCACAGTGGGG + Intergenic
1083056929 11:59830987-59831009 GTACAGCCAAGGCTATAGGTTGG - Intronic
1086804234 11:91219956-91219978 TTAAACTCAAGGCCATAGTGAGG + Intergenic
1087789759 11:102393561-102393583 GTAAAGCCACTGCCATAGTAAGG - Intergenic
1090647325 11:128776612-128776634 CTATCGCCCAGGCCAGAGTGCGG - Intronic
1090650633 11:128802937-128802959 CTATAGCCATGGCCATAATTTGG + Intronic
1093639880 12:21513757-21513779 CTATTGCCCAGGCTATAGTGTGG - Intronic
1095988613 12:48017643-48017665 GTACAGCCCAGACAATAGTGCGG - Intergenic
1099914893 12:88880694-88880716 GTAAACCCAAGGCCCTTGTGAGG + Intergenic
1099915005 12:88882135-88882157 GTAAACCCAAGGCCCTTGTGGGG + Intergenic
1107966276 13:45601147-45601169 TTACAGCCAAGGACAGAGTGGGG - Intronic
1110024305 13:70514994-70515016 GAATAGCCAAGGTGATATTGAGG + Intergenic
1110625357 13:77649647-77649669 GTATAGCCACTGCCATAGTTTGG + Intergenic
1112630148 13:101152082-101152104 GTATATCCAAGGTCAAAGTGGGG + Intronic
1113445809 13:110365652-110365674 GGAGAGCCAAGGCCATTGCGTGG - Intronic
1114820651 14:26014961-26014983 GAATAGCCAAAGCCATCCTGAGG + Intergenic
1115514288 14:34169740-34169762 GTACAGCAAAGGCCAAAGTATGG - Intronic
1116075404 14:40104389-40104411 GTATAGCCAAGACAATCGTAAGG + Intergenic
1118640102 14:67784259-67784281 ATATAGCCAAGGGCTCAGTGCGG - Intronic
1120426659 14:84356832-84356854 GAATAGCCAAAGCCATTTTGAGG + Intergenic
1120686549 14:87544380-87544402 TTATAGCCATGGCAATGGTGTGG + Intergenic
1126866907 15:52946725-52946747 ATAAAGCCAAGGCCTAAGTGTGG - Intergenic
1128829022 15:70749487-70749509 TTATCGCCCAGGCCAGAGTGCGG - Intronic
1133707709 16:8370951-8370973 GCATAGCCAAGGCCATTGGAAGG - Intergenic
1135907714 16:26528483-26528505 GTACACCCAAGGTCATTGTGGGG + Intergenic
1139769716 16:69264199-69264221 GTGATGCCAAGGCCATTGTGAGG + Intronic
1140651832 16:77096715-77096737 GTGTAGAGAAGGACATAGTGTGG - Intergenic
1150545507 17:66153681-66153703 GAATAGCCAAGGCAATCTTGAGG + Intronic
1157516608 18:48315862-48315884 GTATAATCAAGGCCATGGAGAGG + Intronic
1168342604 19:55634216-55634238 GTAACGCCAAGGCCATAGAGGGG - Intergenic
928439821 2:31283140-31283162 GTAAAGCCAAGGCCACAGGCTGG + Intergenic
930980571 2:57521390-57521412 GTATAGCCAAAGTCATCCTGAGG - Intergenic
931968865 2:67564184-67564206 GAATAGTCTAAGCCATAGTGTGG + Intergenic
935926349 2:108073959-108073981 GTATAGCCAAGGCACTATTGTGG - Intergenic
939590044 2:144053741-144053763 ATTTAGCCAAGGCCAGATTGAGG + Intronic
943334097 2:186592394-186592416 CTATCGCCCAGGCCACAGTGTGG - Intronic
945057127 2:205878910-205878932 GAATATCCAAGGCCCTTGTGGGG + Intergenic
946467181 2:219922337-219922359 ATATAGCCAAAGCTTTAGTGTGG + Intergenic
1172346215 20:34202779-34202801 GAATAGCCAAGGCAATCTTGGGG - Intronic
1173462177 20:43251867-43251889 GTGGAGCCATTGCCATAGTGGGG + Intergenic
1183133010 22:35857626-35857648 AAATAGCCATGGCCATAATGGGG + Intronic
1183755623 22:39760744-39760766 GTATAGCCAAAGTCCTACTGAGG - Intronic
1184730919 22:46370626-46370648 GCATAGCCTAGGCCAGGGTGGGG - Intronic
1184752331 22:46494284-46494306 GAATAGCCAAGGCCACTTTGAGG - Intronic
1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG + Intronic
949942742 3:9167231-9167253 GTCAAGGCAAGGCTATAGTGAGG - Intronic
951736686 3:25873982-25874004 GTAAAGCCAAGCCCAGAGTAAGG + Intergenic
965662403 3:171055551-171055573 GTATAGCCAGGGTCATAGCCCGG + Intergenic
966718332 3:183036244-183036266 GCATAGGAAGGGCCATAGTGGGG - Intronic
974267649 4:59605463-59605485 GAATAGCCAAGGCCATGCTGAGG + Intergenic
975935379 4:79573188-79573210 GTATAGCCCAGGCCAGTATGAGG - Intergenic
976151189 4:82093594-82093616 GTATCGTCCAGGCCAGAGTGCGG - Intergenic
978764507 4:112390377-112390399 TTATAGCCAAGCCTATATTGAGG - Intronic
979762651 4:124426021-124426043 GCAAAGCCAAGGCTATATTGGGG - Intergenic
981298971 4:143165777-143165799 GACTAGCCAGGGCAATAGTGAGG - Intergenic
981546351 4:145898116-145898138 CTATAGCCCAGGCTAGAGTGCGG - Intronic
984707427 4:182857818-182857840 TTCTAGACAGGGCCATAGTGAGG - Intergenic
986714082 5:10510102-10510124 GTATAGCCGTAGCCATAGAGTGG - Intronic
987530224 5:19108991-19109013 GAATAGCCAAAGCAATACTGAGG - Intergenic
994389948 5:99180520-99180542 GTATACACATGGACATAGTGTGG - Intergenic
997591278 5:135074087-135074109 TTATAGCCAAAGCCAGAGAGGGG + Intronic
997717009 5:136049881-136049903 GAATAGCCAAGGCCAGAGCAAGG + Intronic
999185980 5:149709317-149709339 GTACAGCCAGGGCCAGAATGAGG + Intergenic
1002864930 6:1113015-1113037 TTATTGCCAAGGCCAAAGTCAGG - Intergenic
1006459875 6:34152135-34152157 GTAGAACCAAGGCTAGAGTGTGG - Intronic
1008237421 6:49067036-49067058 GAATAGCCAATGCCATCCTGAGG + Intergenic
1019852613 7:3574556-3574578 CCAGAGCCAAGGGCATAGTGGGG - Intronic
1031892660 7:127312974-127312996 GAATAGCCAAAGCCATCCTGAGG + Intergenic
1036787052 8:11694979-11695001 GTATATACAAGTCCAGAGTGTGG + Intronic
1038375906 8:27040119-27040141 CCATTGCCAAAGCCATAGTGTGG + Intergenic
1043231509 8:77807995-77808017 GAATAGCCAAAGCAATACTGAGG + Intergenic
1046449797 8:114373315-114373337 GTTTAGCCAAGGACATAGTCTGG + Intergenic
1052262124 9:26529209-26529231 GTATATCCTTGGGCATAGTGGGG - Intergenic
1053537140 9:38937370-38937392 TTATAACCAAGGGCATGGTGGGG + Intergenic
1054628995 9:67426560-67426582 TTATAACCAAGGGCATGGTGGGG - Intergenic
1054784802 9:69200422-69200444 GTATTGCCAAGGCTGGAGTGTGG + Intronic
1056370180 9:85946212-85946234 CTATAGTCAAGGCTGTAGTGAGG - Intronic
1058931955 9:109729396-109729418 GTATAGCCAAAGGCATCATGAGG + Intronic
1060867719 9:127013253-127013275 ACAGAACCAAGGCCATAGTGGGG - Intronic
1189904274 X:45742039-45742061 GCATAGTAAAGGCCATCGTGAGG + Intergenic
1192528375 X:71867233-71867255 GTATACCCTAGGCCATGGTCGGG - Intergenic
1193880135 X:86911321-86911343 GTACAACTAAGGCCACAGTGGGG - Intergenic
1194831981 X:98634307-98634329 GTATAGCCAAAGCTATCTTGAGG + Intergenic
1199539664 X:148945079-148945101 CTATATCCATGGCCGTAGTGGGG - Intronic
1199757773 X:150881232-150881254 ATAGAGCCAAGGCCACAGAGTGG - Intronic