ID: 1185045845

View in Genome Browser
Species Human (GRCh38)
Location 22:48528386-48528408
Sequence TAGCCAAGGCCATAGTGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 300}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185045838_1185045845 -2 Left 1185045838 22:48528365-48528387 CCATTCCCCGATGCCTGTGTATA 0: 1
1: 0
2: 0
3: 4
4: 138
Right 1185045845 22:48528386-48528408 TAGCCAAGGCCATAGTGAGGAGG 0: 1
1: 0
2: 1
3: 10
4: 300
1185045834_1185045845 24 Left 1185045834 22:48528339-48528361 CCAGGAAAGGGTTCTGCTCTGGG 0: 1
1: 0
2: 1
3: 21
4: 232
Right 1185045845 22:48528386-48528408 TAGCCAAGGCCATAGTGAGGAGG 0: 1
1: 0
2: 1
3: 10
4: 300
1185045839_1185045845 -7 Left 1185045839 22:48528370-48528392 CCCCGATGCCTGTGTATAGCCAA 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1185045845 22:48528386-48528408 TAGCCAAGGCCATAGTGAGGAGG 0: 1
1: 0
2: 1
3: 10
4: 300
1185045840_1185045845 -8 Left 1185045840 22:48528371-48528393 CCCGATGCCTGTGTATAGCCAAG 0: 1
1: 0
2: 1
3: 7
4: 95
Right 1185045845 22:48528386-48528408 TAGCCAAGGCCATAGTGAGGAGG 0: 1
1: 0
2: 1
3: 10
4: 300
1185045841_1185045845 -9 Left 1185045841 22:48528372-48528394 CCGATGCCTGTGTATAGCCAAGG 0: 1
1: 0
2: 0
3: 16
4: 122
Right 1185045845 22:48528386-48528408 TAGCCAAGGCCATAGTGAGGAGG 0: 1
1: 0
2: 1
3: 10
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185045845 Original CRISPR TAGCCAAGGCCATAGTGAGG AGG Intronic
900148721 1:1169165-1169187 GGGCACAGGCCATAGTGAGGGGG - Intergenic
900352993 1:2245834-2245856 TTGCCCAGGCCAGAGTGCGGTGG + Intronic
901345283 1:8535103-8535125 TTGCCCAGGCTAGAGTGAGGTGG - Intronic
902996511 1:20229615-20229637 TAGCATATGCCACAGTGAGGAGG + Intergenic
904231782 1:29080156-29080178 TAGCCCAGGCCAAAGTGCAGTGG + Intronic
905312811 1:37062235-37062257 TGGCCAAGGCCACAGCCAGGAGG + Intergenic
905738311 1:40347081-40347103 TTGCCCAGGCCAGAGTGCGGTGG + Intronic
905801605 1:40847643-40847665 TGGCCAAGCCCAAAGTCAGGGGG - Intergenic
905853514 1:41291425-41291447 TAGCCAAGGGGATAGAGAGCTGG - Intergenic
906173183 1:43745666-43745688 TAGCCCAGGCCAGAGTGCAGTGG + Intronic
906784660 1:48604091-48604113 TAGCCCAGGCTGTAGTGCGGTGG - Intronic
908050916 1:60229498-60229520 TAGCCAAGGGGCCAGTGAGGAGG - Intergenic
908827286 1:68146044-68146066 TAGCCAAGGCCAAGTTGAGCCGG + Intronic
909357878 1:74730132-74730154 TAGCCAATGCCAAAATGTGGGGG - Intronic
910208647 1:84772712-84772734 TGGCAAAGGCCTTAGTGCGGTGG + Intergenic
912240456 1:107902001-107902023 TAGTCAAGGCCAGAGTGCAGTGG - Intronic
912263385 1:108131130-108131152 TAGAGAAGGCCTTATTGAGGAGG - Intergenic
912802339 1:112728021-112728043 TCACCAAGGCCTTAGGGAGGGGG + Intergenic
914337301 1:146726973-146726995 TTGCCCAGGCCAGAGTGAAGTGG + Intergenic
914735459 1:150412081-150412103 TCGCCCAGGCCAGAGTGCGGTGG - Intronic
915449080 1:155992306-155992328 TCGCCCAGGCCATAGTGCAGTGG + Intronic
915467304 1:156105108-156105130 AGGTCAAGGCCAAAGTGAGGTGG + Intronic
916174419 1:162025545-162025567 TAGCCCAGGCTATAGTGCAGTGG - Intergenic
917491793 1:175504535-175504557 CAGCCACAGCCAGAGTGAGGGGG - Intronic
919524460 1:198630299-198630321 TTGCCCAGGCTATAGTGAAGTGG + Intergenic
920181673 1:204135569-204135591 TAGCCAACCCCTGAGTGAGGAGG - Intronic
920232938 1:204482265-204482287 TAGCCAAGGCCAGGGTTTGGAGG - Intronic
921329381 1:214020222-214020244 GATCCAAGGAAATAGTGAGGGGG - Intronic
922047529 1:221961089-221961111 TCGCCCAGGCCAGAGTGAAGGGG + Intergenic
922401383 1:225260618-225260640 TAGCCAAAGCAATCTTGAGGGGG - Intronic
923775073 1:236970741-236970763 TTGCCCAGGCCAAAGTGCGGTGG + Intergenic
1063554992 10:7069882-7069904 TAGCCAAGGCCAGCGGGAGATGG + Intergenic
1064174011 10:13058464-13058486 TTGCTTAGGCCATATTGAGGGGG - Intronic
1064365967 10:14708115-14708137 TTGCCCAGGCTATAGTGAAGTGG + Intronic
1068877221 10:62009760-62009782 TGGCTAAGGGCAAAGTGAGGAGG + Intronic
1070583396 10:77742085-77742107 TGGCCAAGGCAAGAGTGATGTGG - Intergenic
1070999436 10:80816146-80816168 TAGCCAAGGCCACATGGAGCAGG + Intergenic
1072678460 10:97487356-97487378 TCGCCCAGGCCAGAGTGCGGTGG + Intronic
1073310121 10:102534385-102534407 TAGCCCAGGCCAGAGTGCAGTGG - Intronic
1073320578 10:102613893-102613915 GTGCCAAGGCCACAGTCAGGAGG + Intronic
1073393311 10:103197269-103197291 CATCCAAGGCCACAGTGGGGTGG - Intergenic
1073466212 10:103695954-103695976 TCCTCAAGGCCATAGTGAGTGGG + Intronic
1074011930 10:109490853-109490875 TTGCCCAGGCCAGAGTGAAGTGG - Intergenic
1075549078 10:123378971-123378993 CAGCCAAGGCCATGCTGAGCAGG + Intergenic
1076347365 10:129788614-129788636 AAGCCAAAGCCCTTGTGAGGTGG - Intergenic
1076746406 10:132517027-132517049 TGGCCAGGGCCACAGTGGGGCGG + Intergenic
1076993264 11:286622-286644 TGGCCCAGGCCAGAGTGTGGTGG - Intergenic
1077127339 11:947047-947069 TCGCCAAGGCTAGAGTGCGGTGG + Intronic
1077769522 11:5200310-5200332 GGTCAAAGGCCATAGTGAGGAGG + Exonic
1078394443 11:10967630-10967652 TTGCCCAGGCCATAGTGCAGTGG + Intergenic
1078564015 11:12398179-12398201 CATCCAAAGCCATGGTGAGGAGG + Intronic
1080279575 11:30541046-30541068 TAGCCCAGGCCATGGGGAGGTGG + Intronic
1080964289 11:37196089-37196111 CAGCAAAGGCCATGCTGAGGAGG - Intergenic
1081746376 11:45475262-45475284 CAGCAAAGGCCATATTGAGCAGG - Intergenic
1082842579 11:57701035-57701057 TACCCAGCACCATAGTGAGGTGG - Exonic
1083255367 11:61492036-61492058 CAGCCACGGCCATAGTAAGGAGG + Intergenic
1083362490 11:62120591-62120613 TAACCAAGCCCAGAGGGAGGCGG + Intergenic
1083599806 11:63939527-63939549 TAGCCAAGGTCATATTGTCGGGG + Intronic
1084139938 11:67219976-67219998 TAGCCAACACCATAGTGAATGGG + Intronic
1085457787 11:76675017-76675039 GAGCCAAGGCCAGGATGAGGTGG + Intergenic
1087774563 11:102245472-102245494 TTGCCCAGGCTAGAGTGAGGTGG + Intergenic
1088480284 11:110290470-110290492 TTGCCCAGGCCAGAGTGCGGTGG - Intronic
1088734458 11:112716978-112717000 AAGTCTAGGCCATAATGAGGAGG - Intergenic
1089576668 11:119449206-119449228 TTGCCCAGGCCAGAGTGCGGTGG + Intergenic
1090647324 11:128776609-128776631 TCGCCCAGGCCAGAGTGCGGTGG - Intronic
1090707216 11:129349446-129349468 TTGCCCAGGCCAGAGTGAAGTGG + Intergenic
1090885460 11:130872340-130872362 AAGCCAAGGCCACCGTGAAGCGG - Intergenic
1091430222 12:427512-427534 TCGCCCAGGCCAGAGTGCGGTGG + Intronic
1091469842 12:717275-717297 TTGCCCAGGCTAGAGTGAGGTGG + Intergenic
1091493853 12:955511-955533 TCGCCCAGGCCATAGTGCAGTGG + Intronic
1092198066 12:6562026-6562048 TTGCCCAGGCTAGAGTGAGGTGG + Intronic
1092678855 12:10954505-10954527 TTGCCCAGGCCATAGTGCAGTGG + Intronic
1093467046 12:19460167-19460189 TTGCCAAGCCTATAGTGCGGTGG - Intronic
1093639879 12:21513754-21513776 TTGCCCAGGCTATAGTGTGGCGG - Intronic
1095961420 12:47836727-47836749 TAGCCAAGTACAGAATGAGGGGG + Intergenic
1096600336 12:52724420-52724442 TAGCCATGGCCACGGAGAGGAGG - Intergenic
1097081517 12:56434695-56434717 TTGCCCAGGCCAGAGTGTGGCGG - Intronic
1097099275 12:56575395-56575417 TAGCCCAGGCCAGAGTGCAGTGG - Intronic
1099058821 12:77879639-77879661 TCGCCAAGGCTATAGTGAAGTGG - Intronic
1100308766 12:93375870-93375892 TAAAAAAGACCATAGTGAGGAGG + Intergenic
1101416831 12:104515738-104515760 TAGGAAAGGCCATACTGAGAAGG + Intronic
1102113595 12:110383834-110383856 TAGCCAAGGCTAGAGTGCAGTGG - Intronic
1103109695 12:118264992-118265014 TTGCCCAGGCCAGAGTGAAGTGG - Intronic
1105782720 13:23718155-23718177 TGGCCAAGGCCAGTGTTAGGTGG + Intergenic
1107459897 13:40591739-40591761 TCGCCCAGGCTAGAGTGAGGTGG + Intronic
1107541120 13:41390059-41390081 TAGCCCAGGCCAGAGTGCAGCGG + Intergenic
1108005517 13:45942133-45942155 TAGCCAAGGCCACAGTGATGGGG - Intergenic
1108200486 13:48038317-48038339 TAGCCCAGGCCAGAGTGCAGTGG + Intronic
1108317581 13:49252237-49252259 TACCCAAGACCATGGTGAGAGGG - Intronic
1108484237 13:50908918-50908940 TAGCCCAGGCCAGAGTGCAGTGG + Intergenic
1112441268 13:99426542-99426564 TGGCCAAGGGGATACTGAGGTGG - Intergenic
1114442890 14:22765360-22765382 TCGCCCAGGCTAGAGTGAGGTGG + Intergenic
1115599050 14:34938056-34938078 TTGCCCAGGCTATAGTGTGGTGG - Intergenic
1116273003 14:42796401-42796423 TAGCCAATACCATAGTGAATGGG - Intergenic
1117659446 14:57988334-57988356 TAGCCAGGGCCACTGTGAGAAGG + Intergenic
1118207897 14:63740308-63740330 TTGCCAAGGCCAGAGTGTAGTGG + Intergenic
1118640101 14:67784256-67784278 TAGCCAAGGGCTCAGTGCGGTGG - Intronic
1118778378 14:68988899-68988921 TGGCCAAGGCCAAGGTGTGGGGG - Intergenic
1119906182 14:78304191-78304213 AAGAGAAGGCCTTAGTGAGGAGG - Intronic
1120966247 14:90170251-90170273 TTGCCCAGGCCAGAGTGCGGTGG + Intronic
1121548780 14:94782321-94782343 TTGCCCAGGCTAGAGTGAGGTGG - Intergenic
1122316630 14:100829168-100829190 AAACCAATGCCCTAGTGAGGGGG + Intergenic
1124323060 15:28730378-28730400 TAGCCAAGGCTAGAGTGCAGTGG - Intronic
1125842571 15:42818113-42818135 TAGCCCAGGCTATAGTGCAGTGG + Intronic
1125851081 15:42903255-42903277 TACCAAGGGCCATGGTGAGGAGG + Intronic
1126040146 15:44582506-44582528 TCGCCCAGGCCAGAGTGTGGTGG - Intronic
1126108721 15:45163334-45163356 TGGCCCAGGGCATAGAGAGGTGG - Intronic
1126629692 15:50721468-50721490 TCGCCCAGGCTATAGTGAAGTGG + Intronic
1127923234 15:63511614-63511636 TATCCATAGCTATAGTGAGGAGG - Intronic
1128829021 15:70749484-70749506 TCGCCCAGGCCAGAGTGCGGTGG - Intronic
1130614331 15:85390310-85390332 CAGACAAGGCCTTACTGAGGAGG + Intronic
1130623806 15:85492340-85492362 TAGCCCAGGCTATAGTGCAGTGG - Intronic
1133381814 16:5337177-5337199 AAGCCAAAACCACAGTGAGGGGG - Intergenic
1133831981 16:9331852-9331874 TTGCCCAGGCCATAGTGCAGTGG + Intergenic
1133959537 16:10481268-10481290 TTGCCCAGGCTATAGTGCGGTGG + Intronic
1134026086 16:10955095-10955117 TGTCCAAGGCCACAGTTAGGAGG + Intronic
1134346756 16:13398538-13398560 TAGCCCAGGCTAGAGTGAAGTGG + Intergenic
1134681966 16:16132559-16132581 TTGCCAAGGCCAGAGTGCAGGGG + Intronic
1135625405 16:23990582-23990604 TTGCCCAGGCCAGAGTGTGGTGG + Intronic
1136379153 16:29883890-29883912 TCGCCCAGGCCGTAGTGCGGTGG - Intronic
1136750541 16:32631841-32631863 TTGCCCAGGCCAGAGTGCGGTGG - Intergenic
1139996974 16:70990353-70990375 TTGCCCAGGCCAGAGTGAAGTGG - Intronic
1140083213 16:71770515-71770537 TAGCCCAGGCTATAGTGCAGTGG + Intronic
1141029792 16:80577877-80577899 TCGGCAAGGCCACAGCGAGGGGG + Intergenic
1141106785 16:81240663-81240685 TTGCCAAGGCCAGAGTGCAGTGG - Intronic
1141477680 16:84284500-84284522 TTGCGAAGGCTACAGTGAGGAGG + Intergenic
1203052671 16_KI270728v1_random:891046-891068 TTGCCCAGGCCAGAGTGCGGTGG - Intergenic
1143731520 17:8885287-8885309 GAGGCAAGGCCATGGGGAGGCGG - Intronic
1145204802 17:20978126-20978148 TAGCCCAGGCTGGAGTGAGGTGG + Intergenic
1145822085 17:27846555-27846577 TCGCCCAGGCCAGAGTGCGGTGG + Intronic
1146670335 17:34733151-34733173 TAGCCAAGGCCTCAGGGACGGGG + Intergenic
1147028198 17:37607914-37607936 TTGCCCAGGCCAGAGTGCGGCGG - Intronic
1147582710 17:41636183-41636205 AAGCCAGGGCCCTAGGGAGGGGG + Intergenic
1149977171 17:61278074-61278096 TAGCCCAGGCTGGAGTGAGGTGG + Intronic
1150066632 17:62115547-62115569 TAGCCCAGGCTAGAGTGAAGTGG - Intergenic
1150244110 17:63660978-63661000 TGGCCTTGGCCAAAGTGAGGTGG - Intronic
1152194651 17:78910230-78910252 TAGCCCAGGCTAGAGTGTGGTGG + Intronic
1152342136 17:79731157-79731179 TGGCCAGAGCCACAGTGAGGAGG - Exonic
1152376742 17:79922506-79922528 ATGCCAAGGCCACAGTGATGGGG - Intergenic
1152536804 17:80955190-80955212 CAGCCAAGGCAATATTGAAGAGG + Intronic
1154029254 18:10737098-10737120 CAGACAAGGCCAAAGTGAGGTGG + Intronic
1158051008 18:53220043-53220065 TAGCCAAGTCCATAGCCAAGTGG + Intronic
1158266258 18:55664018-55664040 CAGCAAAGACCAAAGTGAGGAGG + Intronic
1160182568 18:76648078-76648100 GACCCAAGGCCCTGGTGAGGGGG + Intergenic
1161702628 19:5803937-5803959 CAGCCAGGGCCGGAGTGAGGAGG + Intergenic
1162146227 19:8613551-8613573 TTGCCCAGGCTAGAGTGAGGTGG + Intergenic
1163239711 19:16053145-16053167 TGGCAAAGGCCATTCTGAGGAGG - Intergenic
1164569441 19:29361135-29361157 TAGCCCAGGCCAGAGTGCAGTGG - Intergenic
1165085703 19:33345291-33345313 CAGCCGAGGCCACAGTGAGAAGG - Intergenic
1166889524 19:45981953-45981975 TCGCCAAGGCCAGAGTGCTGTGG + Intergenic
1167257029 19:48436826-48436848 TCTCCCAGGCCAGAGTGAGGGGG + Intronic
1167313186 19:48749249-48749271 TAGCCCAGGCCAGAGTGCAGTGG - Exonic
928587361 2:32774219-32774241 TAGCCCAGGCCAGAGTGCAGTGG + Intronic
929600817 2:43203653-43203675 TTGCCAAGGACATGGTGAGCTGG - Intergenic
930293969 2:49530332-49530354 TAGCCAAGGCTAGAGTGACTGGG + Intergenic
931115268 2:59159945-59159967 TTGCCCAGGCTATAGTGAAGTGG + Intergenic
931855965 2:66302021-66302043 CAGCCAAGGACATTGCGAGGTGG - Intergenic
932362806 2:71123040-71123062 GAGTCATGTCCATAGTGAGGAGG - Intronic
933418567 2:82020052-82020074 TAGCCAAAGCAATCCTGAGGGGG + Intergenic
933885405 2:86715174-86715196 TGGTGAAGGCCACAGTGAGGAGG + Intronic
933924770 2:87081517-87081539 TGGTGAAGGCCACAGTGAGGAGG - Intergenic
934872177 2:97876734-97876756 TAGCCAATACCATACTGAGTGGG + Intronic
937077666 2:119118581-119118603 TAGCCAAGATCATAGTCAAGTGG + Intergenic
937995525 2:127691384-127691406 TAGTGAAGGCCAGGGTGAGGAGG - Intergenic
939329314 2:140737180-140737202 TAGCCAAGGCCCTAGGGAGAAGG + Intronic
939394615 2:141612760-141612782 TTTCCAAGGCAATAGTGAGAAGG + Intronic
939708361 2:145483285-145483307 TCGCCCAGGCCAGAGTGCGGTGG + Intergenic
940434317 2:153632790-153632812 TTGCCCAGGCTAGAGTGAGGTGG + Intergenic
943334096 2:186592391-186592413 TCGCCCAGGCCACAGTGTGGTGG - Intronic
945050649 2:205821162-205821184 CAGCCCAGGCCAAAGTGTGGAGG - Intergenic
945796097 2:214366016-214366038 TAGCCCAGGCCAGAGTGCAGTGG + Intronic
945826570 2:214727594-214727616 TAGGCAAGGCCTTAGTGAGTGGG - Exonic
945960220 2:216125733-216125755 TAGCCAGGGCAAGAGTGAGTTGG - Intronic
1169633954 20:7666461-7666483 TTGCCCAGGCCATAGTGCAGTGG + Intergenic
1169895696 20:10503095-10503117 CAGGGTAGGCCATAGTGAGGTGG - Intronic
1172206431 20:33166054-33166076 TTGCCCAGGCTATAGTGAAGTGG + Intronic
1172578528 20:36028588-36028610 TCCCCAAGGCCAAAGTGAAGAGG + Intronic
1173249860 20:41358662-41358684 TGGCCAAGGCCATCGTTTGGTGG + Intronic
1173673405 20:44813498-44813520 TACTCAAGGTCATAGTGAGTAGG + Intergenic
1175051433 20:56159064-56159086 TAGCAAAGTCCACATTGAGGTGG - Intergenic
1176197543 20:63844381-63844403 TGGCCAAGGCCTGGGTGAGGGGG + Intergenic
1177421287 21:20861172-20861194 TACGCAAGGACATAGTGAGAGGG + Intergenic
1178084595 21:29100041-29100063 TCGCCCAGGCTAGAGTGAGGTGG - Intronic
1179057321 21:37948200-37948222 AAGCCAAGAGCAGAGTGAGGGGG + Intergenic
1179122947 21:38565674-38565696 TAGGGAAGGTCATAGGGAGGAGG - Intronic
1179218488 21:39386882-39386904 TTGCCAAGGCTGTAGTGTGGTGG + Intronic
1180859458 22:19069019-19069041 TACCCAAGGCCATGGTGCAGGGG + Intronic
1181558517 22:23685987-23686009 TTGCCCAGGCCATAGTGCAGTGG - Intergenic
1181720385 22:24769754-24769776 TTGCCCAGGCCAGAGTGCGGTGG - Intronic
1181959430 22:26612210-26612232 ATGCCAAGGGCAGAGTGAGGGGG + Intronic
1185045845 22:48528386-48528408 TAGCCAAGGCCATAGTGAGGAGG + Intronic
1185120153 22:48961207-48961229 TTGCCAAGGCTAAAGGGAGGCGG - Intergenic
1185324654 22:50219749-50219771 CAGCCCAGGCCGTGGTGAGGAGG - Exonic
950273075 3:11634715-11634737 TTGCCCAGGCCAGAGTGCGGTGG + Intronic
953542878 3:43837866-43837888 GAGCCAATGTCATAGTGATGTGG - Intergenic
954155735 3:48684110-48684132 GAGCCAAAGCCAGAGTGTGGGGG + Intronic
954294513 3:49666732-49666754 TAGCCAGGGCCACAGTGGAGGGG + Intronic
954671422 3:52293227-52293249 CAGCCAAGGCCAAGGAGAGGAGG - Exonic
955695552 3:61632476-61632498 TAGGGAAGGCCTCAGTGAGGAGG + Intronic
955779140 3:62464629-62464651 TAGGCAAGGCCATAGAAATGAGG - Intronic
956054199 3:65281082-65281104 TAGCCTAGGGCAGAGTCAGGTGG - Intergenic
957093849 3:75759313-75759335 TTGCCCAGGCCATAGTGCAGTGG + Intronic
957181294 3:76881778-76881800 TAGCCAAGGCCATAATCACAGGG - Intronic
957923656 3:86779697-86779719 TAGTAAAGGCCATTGTGATGAGG - Intergenic
958950364 3:100409635-100409657 TAGCCCAGGCCAGAGTGCAGTGG + Intronic
960706119 3:120482788-120482810 TTGCCCAGGCCAGAGTGAAGTGG + Intergenic
962594693 3:136928792-136928814 TAGCCAAGTCCAGTGTGAAGTGG - Intronic
963975893 3:151480512-151480534 CAGCAAGGGCCATAGGGAGGTGG - Intergenic
967732615 3:192919727-192919749 TAGCCCAGGCCAGAGTGCAGTGG + Intergenic
968254038 3:197248940-197248962 TAGCCTAGGCCAGAGTGCAGTGG - Intronic
968672978 4:1862423-1862445 TAGCCAAAGCCAGAGTGAGTGGG + Intergenic
968712111 4:2126777-2126799 CAGGAAAGGCCAGAGTGAGGCGG + Intronic
969010256 4:4055943-4055965 TCGCCCAGGCCAAAGTGATGTGG - Intergenic
970648659 4:18152811-18152833 TAGCCCAGGCCACAGTGCAGTGG - Intergenic
972487586 4:39557052-39557074 TTGCCAAGGCCAGAGTGCAGTGG + Intronic
974540453 4:63226528-63226550 TAGTCATGGCCATAGGGAAGAGG - Intergenic
974617836 4:64312725-64312747 TAGCCCAGGCTAGAGTGCGGTGG - Intronic
974693975 4:65340549-65340571 CTGCCAAGATCATAGTGAGGGGG + Intronic
975935378 4:79573185-79573207 TAGCCCAGGCCAGTATGAGGAGG - Intergenic
976599415 4:86924486-86924508 TAGCCATGGCCCTGGTGTGGTGG - Intronic
977576662 4:98682023-98682045 AATTCAAGGCCATAGTGAGCTGG + Intergenic
979552378 4:122005429-122005451 TAACCAAGGCCAAACTGAGATGG - Intergenic
981546350 4:145898113-145898135 TAGCCCAGGCTAGAGTGCGGTGG - Intronic
981763106 4:148215817-148215839 TCGCCCAGGCCATAGTGCAGTGG + Intronic
983282117 4:165694327-165694349 TTGCCCAGGCCATAGTGCAGTGG + Intergenic
984121500 4:175750610-175750632 TCGCCAAGGCTAGAGTGTGGTGG + Intronic
985591602 5:768295-768317 GAGCCAAGGCCATGGTTTGGAGG + Intergenic
985609518 5:879254-879276 GAGCCAAGGCCATGGTTTGGAGG + Intronic
985629725 5:1008360-1008382 AAACCAAGGACAAAGTGAGGGGG + Intergenic
985705644 5:1400066-1400088 GAGAGAAGGCCATAGTGTGGAGG - Intronic
986828412 5:11547226-11547248 TCGCCCAGGCCAGAGTGCGGTGG - Intronic
987043714 5:14086850-14086872 TTGCCAAGGCCAGAGTGCAGTGG - Intergenic
988044494 5:25932408-25932430 TAGCCAAGGCCGGAGTGCAGTGG - Intergenic
990473776 5:56142292-56142314 TAGCCCAGGCCAGAGTGCAGTGG - Intronic
991302146 5:65139240-65139262 TATACATGGCCATAGAGAGGGGG - Intergenic
991666677 5:69006272-69006294 TTGCCAAGGCCTGAGGGAGGTGG + Intergenic
994429540 5:99639979-99640001 CAGCCAAGGTCATAGTGTTGGGG - Intergenic
996606633 5:125330580-125330602 TATCCAGGGCCATAGTGCTGGGG - Intergenic
996778821 5:127160926-127160948 GACCCAAGGCCCTAGTGGGGTGG + Intergenic
997130911 5:131275334-131275356 TAGCCCAGGCTAGAGTGCGGTGG + Intronic
997314892 5:132924212-132924234 TTGCCCAGGCCAGAGTGCGGTGG - Intronic
997828195 5:137126416-137126438 TAGCAAAGGCCATTCTGATGAGG + Intronic
999185981 5:149709320-149709342 CAGCCAGGGCCAGAATGAGGTGG + Intergenic
999319780 5:150606735-150606757 GAGCCAAGGCTTCAGTGAGGAGG + Intronic
999880432 5:155857195-155857217 TCGCCCAGGCCATAGTGCAGTGG - Intergenic
1001857994 5:175029405-175029427 GAGCCAATGCAATAGAGAGGGGG - Intergenic
1004769739 6:18768585-18768607 TTGCCCAGGCTAGAGTGAGGTGG - Intergenic
1005432495 6:25773090-25773112 TGGCCAAGGCCAAAGTCAAGTGG + Intronic
1006148089 6:31971111-31971133 TGGCAGAGGCCATAGTGACGTGG - Exonic
1008145406 6:47885856-47885878 TCACCCAGGCCATAGTGCGGTGG + Intronic
1015373350 6:132481036-132481058 TAGCCAATGCCAAATTTAGGGGG - Intronic
1015653095 6:135485111-135485133 TAGCCCAGGCTGGAGTGAGGTGG + Intronic
1016004012 6:139070799-139070821 TTGCCCAGGCTATAGTGAAGTGG - Intergenic
1016146470 6:140680010-140680032 TAACCAAGGCCAGAGTGCAGTGG - Intergenic
1019098235 6:169604980-169605002 TAGCCAAGGTCATACTGAATGGG + Intronic
1019847579 7:3521599-3521621 TAGCAAAGGCCTTATAGAGGAGG + Intronic
1019852612 7:3574553-3574575 GAGCCAAGGGCATAGTGGGGAGG - Intronic
1021345632 7:19524856-19524878 CATCCAAGGACATAGTGAGATGG - Intergenic
1022573828 7:31478850-31478872 TAGCCCAGCCAACAGTGAGGGGG + Intergenic
1024808162 7:53173631-53173653 TAGCCAAAGCAATATTGAGAAGG - Intergenic
1026775435 7:73228196-73228218 TTGCCCAGGCCAGAGTGAAGTGG + Intergenic
1027071736 7:75164371-75164393 TTGCCCAGGCCAGAGTGAAGTGG - Intergenic
1027175104 7:75898512-75898534 TAGCCCAGGCCAAAGTGCAGAGG + Intergenic
1028247781 7:88502866-88502888 TAGCCCAGGCTAGAGTGTGGTGG + Intergenic
1032015618 7:128378777-128378799 TAGCCAGGGCCACTGGGAGGGGG - Intergenic
1032333735 7:131005014-131005036 TTGCCCAGGCCATAGTGCAGGGG + Intergenic
1033318574 7:140318793-140318815 TAGCAAGGGCCTTGGTGAGGTGG + Intronic
1034479267 7:151307359-151307381 GAGCAAAGGCCAGAGGGAGGTGG + Intergenic
1035071440 7:156148093-156148115 TGGCCAAGGACACTGTGAGGGGG + Intergenic
1037317461 8:17612409-17612431 TTGCCCAGGCCATAGTGCAGTGG + Intronic
1037394442 8:18427431-18427453 TTGCCCAGGCCTTAGTGAAGTGG + Intergenic
1037823250 8:22145855-22145877 TAGCCCAGGCTGGAGTGAGGTGG - Intergenic
1038734339 8:30155882-30155904 TAGCCCAGGCCGGAGTGCGGTGG + Intronic
1038942685 8:32323007-32323029 TATCGAGGGCCATAGTTAGGTGG - Intronic
1040030315 8:42817999-42818021 TGGCCAAGGCTAGAGTGCGGTGG + Intergenic
1040909179 8:52501204-52501226 TGGCCAAGGACAAAGAGAGGGGG + Intergenic
1041724091 8:61002367-61002389 TTGCCAAGGCTAGAGTGAAGTGG + Intergenic
1042150297 8:65775665-65775687 TAGCCAAGGCTTGAGTGAAGTGG + Intronic
1043764013 8:84106229-84106251 TAGCCCAGGCTAGAGTGCGGTGG + Intergenic
1044139168 8:88627797-88627819 TAGCCAAAGCAATCCTGAGGGGG - Intergenic
1045821930 8:106348857-106348879 TAGCATAGGCCACACTGAGGAGG + Intronic
1046367321 8:113252607-113252629 TAGAGAAGGCCATAGAGAGAAGG - Intronic
1046631258 8:116625145-116625167 TTGCCCAGGCCAGAGTGAAGTGG + Intergenic
1049090702 8:140511633-140511655 CGGCCAAGGCCACGGTGAGGGGG + Exonic
1049342153 8:142118933-142118955 CAGCCAAGGCCCTGATGAGGGGG - Intergenic
1049972902 9:837209-837231 TTGCCTAGGCTATAGTGTGGTGG + Intergenic
1050599295 9:7234454-7234476 TAGCCCAGGCTGTAGTGAAGTGG + Intergenic
1051246290 9:15115325-15115347 TAGCAAAGGCCAAAGTAAAGTGG - Intergenic
1051583194 9:18699362-18699384 TAGCCCAGGCTAGAGTGCGGTGG + Intronic
1052234653 9:26195505-26195527 TATCCAAGCACATAATGAGGTGG - Intergenic
1052996068 9:34552195-34552217 CAGCCAGGGCCAGAGTGATGGGG + Exonic
1055183403 9:73418970-73418992 TAGCCAAGCCCAAAGTCAGTTGG - Intergenic
1055474191 9:76645152-76645174 TTGCTAAGGCCATGCTGAGGGGG + Intronic
1056083631 9:83123198-83123220 TAGCCCAGGCCAGAGTGCAGAGG - Intergenic
1056130653 9:83583646-83583668 TAGCCCAGGCCGGAGTGTGGTGG + Intergenic
1056586161 9:87928532-87928554 TAGCCAAGACAATAGGGAAGAGG - Intergenic
1056610721 9:88124411-88124433 TAGCCAAGACAATAGGGAAGAGG + Intergenic
1056968543 9:91184157-91184179 AAGCCAAGGCCATCTGGAGGAGG + Intergenic
1057592097 9:96381483-96381505 GAGCCAAGACCAGAGTGAGGTGG - Intronic
1188194666 X:27218267-27218289 GAGCCAAAGCAATTGTGAGGTGG - Intergenic
1188448134 X:30278621-30278643 TTGCCAAGGCCAGAGTGCAGTGG - Intergenic
1189784980 X:44551217-44551239 TTGCCCAGGCTGTAGTGAGGTGG + Intergenic
1191736188 X:64390689-64390711 TCGCCTAGGCCAGAGTGAAGTGG + Intronic
1192737000 X:73858986-73859008 TAGCCCAGGCCAGAGTGCAGTGG + Intergenic
1194899828 X:99496937-99496959 TGGCCAAGGCTATAGTGCAGTGG - Intergenic
1197573729 X:128181712-128181734 CAGCCAATGTCATAGTGAGTGGG + Intergenic
1198407095 X:136324445-136324467 TAGCCAAGGCTAGAGTGAAGTGG + Intronic
1198726628 X:139685036-139685058 TAGCCAAGGTCATACTGAATGGG + Intronic
1199134394 X:144233651-144233673 CAGCGAAGGCCAGGGTGAGGAGG + Intergenic
1200018622 X:153183330-153183352 CAGCCAAGGCCAGTGGGAGGGGG + Exonic
1200324419 X:155222880-155222902 TTGCCCAGGCCAGAGTGCGGTGG + Intronic
1201967693 Y:19755559-19755581 AACCCAAGGCCTTAGTGAAGTGG + Intergenic