ID: 1185045845

View in Genome Browser
Species Human (GRCh38)
Location 22:48528386-48528408
Sequence TAGCCAAGGCCATAGTGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185045834_1185045845 24 Left 1185045834 22:48528339-48528361 CCAGGAAAGGGTTCTGCTCTGGG No data
Right 1185045845 22:48528386-48528408 TAGCCAAGGCCATAGTGAGGAGG No data
1185045841_1185045845 -9 Left 1185045841 22:48528372-48528394 CCGATGCCTGTGTATAGCCAAGG No data
Right 1185045845 22:48528386-48528408 TAGCCAAGGCCATAGTGAGGAGG No data
1185045839_1185045845 -7 Left 1185045839 22:48528370-48528392 CCCCGATGCCTGTGTATAGCCAA No data
Right 1185045845 22:48528386-48528408 TAGCCAAGGCCATAGTGAGGAGG No data
1185045840_1185045845 -8 Left 1185045840 22:48528371-48528393 CCCGATGCCTGTGTATAGCCAAG No data
Right 1185045845 22:48528386-48528408 TAGCCAAGGCCATAGTGAGGAGG No data
1185045838_1185045845 -2 Left 1185045838 22:48528365-48528387 CCATTCCCCGATGCCTGTGTATA No data
Right 1185045845 22:48528386-48528408 TAGCCAAGGCCATAGTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185045845 Original CRISPR TAGCCAAGGCCATAGTGAGG AGG Intronic